Mutagenetix > Incidental Mutations

Incidental Mutation 'R5215:Cps1'

403384

Institutional Source

Beutler Lab

Gene Symbol

Cps1

Ensembl Gene

ENSMUSG00000025991

Gene Name

carbamoyl-phosphate synthetase 1

Synonyms

CPSase I, D1Ucla3, CPS, 4732433M03Rik

MMRRC Submission

042788-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5215 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67123026-67231259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67166380 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 521 (F521I)

Ref Sequence

ENSEMBL: ENSMUSP00000027144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027144]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027144
AA Change: F521I

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: F521I

Domain	Start	End	E-Value	Type
CPSase_sm_chain	44	184	2.5e-70	SMART
Pfam:GATase	221	397	1.5e-40	PFAM
low complexity region	426	436	N/A	INTRINSIC
Pfam:ATP-grasp_4	543	724	6.8e-12	PFAM
Pfam:CPSase_L_D2	546	750	1.7e-85	PFAM
Pfam:ATP-grasp	554	722	4.9e-8	PFAM
Pfam:Dala_Dala_lig_C	561	718	1.5e-7	PFAM
CPSase_L_D3	839	962	1.18e-57	SMART
Pfam:ATP-grasp_4	1085	1264	1e-19	PFAM
Pfam:CPSase_L_D2	1088	1291	7.4e-32	PFAM
Pfam:Dala_Dala_lig_C	1095	1279	1.6e-6	PFAM
Pfam:ATP-grasp	1096	1263	2.8e-12	PFAM
MGS	1373	1465	1.53e-15	SMART

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alas1	C	A	9: 106,243,375	A73S	probably benign	Het
Aldoart2	G	A	12: 55,565,419	R43Q	probably benign	Het
Ano4	T	C	10: 89,317,303	H49R	possibly damaging	Het
Atic	T	C	1: 71,564,507	S161P	probably damaging	Het
Atp6v1c2	T	C	12: 17,291,658	E244G	probably benign	Het
Cd164l2	C	A	4: 133,221,478	L42I	unknown	Het
Cdc42ep2	T	C	19: 5,918,210	R156G	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk5	T	A	5: 24,419,461	N265I	probably benign	Het
Cfap69	G	T	5: 5,589,133	N262K	possibly damaging	Het
Chd6	C	T	2: 160,949,953	V2495M	probably damaging	Het
Crb2	A	G	2: 37,793,753	E1089G	probably benign	Het
Decr1	T	C	4: 15,929,795	D166G	probably damaging	Het
Dhodh	G	A	8: 109,606,343		probably benign	Het
Dnaaf5	G	A	5: 139,161,877	V399I	probably benign	Het
Dnah11	T	C	12: 118,157,361	T526A	probably benign	Het
Drosha	T	C	15: 12,885,133		probably benign	Het
Elfn2	T	A	15: 78,674,201	I49F	probably damaging	Het
Gabra1	T	C	11: 42,154,828	T152A	probably damaging	Het
Gigyf2	C	A	1: 87,365,266	T85K	probably damaging	Het
Gimap8	A	T	6: 48,651,083	Y258F	possibly damaging	Het
Glmn	A	G	5: 107,561,886	C351R	probably benign	Het
Gm10032	T	C	14: 66,792,549		noncoding transcript	Het
Gm340	T	C	19: 41,585,932	I1042T	probably damaging	Het
Gorasp2	G	A	2: 70,689,254	A328T	probably benign	Het
Grin1	A	T	2: 25,303,907	H392Q	probably benign	Het
Gzmn	A	G	14: 56,167,862	V55A	probably damaging	Het
Herc4	T	A	10: 63,289,097	S497T	probably benign	Het
Hrc	A	T	7: 45,336,091	D222V	probably damaging	Het
Iars2	T	C	1: 185,294,769	H761R	probably damaging	Het
Jmjd1c	T	A	10: 67,240,701	D2101E	possibly damaging	Het
Kcng1	C	T	2: 168,263,133	M264I	probably benign	Het
Klra14-ps	C	A	6: 130,157,683		noncoding transcript	Het
Krtap5-3	T	A	7: 142,202,237	C270*	probably null	Het
Lama3	A	G	18: 12,577,900	H3164R	probably damaging	Het
Mdn1	T	C	4: 32,741,418	M3840T	possibly damaging	Het
Mtor	A	T	4: 148,453,983	H166L	probably benign	Het
Mx1	T	C	16: 97,448,360	N556D	possibly damaging	Het
Oca2	A	T	7: 56,295,498	R285*	probably null	Het
Olfr103	T	A	17: 37,336,813	I140F	probably benign	Het
Olfr1285	T	C	2: 111,409,286		noncoding transcript	Het
Olfr521	A	G	7: 99,767,510	E116G	probably damaging	Het
Olfr681	G	A	7: 105,126,564	H246Y	probably damaging	Het
Olfr952	A	T	9: 39,426,623	Y149*	probably null	Het
Pan3	A	G	5: 147,455,105		probably null	Het
Pard3	G	A	8: 127,378,264	V496M	probably damaging	Het
Pdcd2l	A	T	7: 34,192,889	V185D	possibly damaging	Het
Pgghg	T	C	7: 140,946,564	V623A	possibly damaging	Het
Pigu	C	A	2: 155,335,329		probably benign	Het
Pkmyt1	G	A	17: 23,732,592	R40Q	probably benign	Het
Prag1	G	A	8: 36,099,889	A65T	probably benign	Het
Prkdc	C	A	16: 15,772,121	T2616N	possibly damaging	Het
Prpf8	G	A	11: 75,500,204	E1360K	probably benign	Het
Ptprt	C	T	2: 162,278,164	V128M	probably damaging	Het
Rp1l1	C	T	14: 64,030,013	S1016L	probably benign	Het
Rprd1a	G	T	18: 24,488,200	D307E	probably damaging	Het
Slc11a1	A	T	1: 74,383,777		probably benign	Het
Slc22a16	T	A	10: 40,581,390	M209K	probably damaging	Het
Slf2	T	G	19: 44,948,037	L707R	probably damaging	Het
Son	T	A	16: 91,656,675	M770K	probably damaging	Het
Taf6l	T	C	19: 8,778,053		probably benign	Het
Tbc1d2	C	A	4: 46,614,006	V692L	probably benign	Het
Tnpo3	C	T	6: 29,582,153		probably benign	Het
Txndc16	A	T	14: 45,211,140		probably benign	Het
Ubr1	T	C	2: 120,904,044	K1125R	probably benign	Het
Vmn2r9	A	G	5: 108,846,485	S433P	probably benign	Het
Zc3h12a	A	G	4: 125,126,913	S46P	probably benign	Het
Zwilch	T	G	9: 64,146,874	I490L	probably benign	Het

Other mutations in Cps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Cps1	APN	1	67152380	splice site	probably benign
IGL00897:Cps1	APN	1	67215564	missense	probably benign	0.08
IGL00928:Cps1	APN	1	67123234	missense	probably benign
IGL01063:Cps1	APN	1	67195166	missense	possibly damaging	0.91
IGL01081:Cps1	APN	1	67206824	missense	probably damaging	1.00
IGL01361:Cps1	APN	1	67195145	missense	probably benign	0.03
IGL01396:Cps1	APN	1	67157786	missense	probably damaging	1.00
IGL01516:Cps1	APN	1	67230284	missense	probably damaging	0.99
IGL01695:Cps1	APN	1	67197035	missense	probably benign
IGL02022:Cps1	APN	1	67172872	splice site	probably benign
IGL02032:Cps1	APN	1	67230315	missense	probably benign	0.03
IGL02049:Cps1	APN	1	67143954	missense	possibly damaging	0.68
IGL02197:Cps1	APN	1	67157764	missense	probably benign
IGL02217:Cps1	APN	1	67174382	missense	probably benign	0.06
IGL02555:Cps1	APN	1	67214021	missense	probably benign	0.06
IGL02570:Cps1	APN	1	67148703	splice site	probably benign
IGL02633:Cps1	APN	1	67123237	missense	probably benign
IGL02711:Cps1	APN	1	67212517	splice site	probably benign
IGL02737:Cps1	APN	1	67148774	missense	probably benign	0.35
IGL03030:Cps1	APN	1	67142921	missense	probably damaging	1.00
IGL03255:Cps1	APN	1	67145801	nonsense	probably null
Madman	UTSW	1	67160871	missense	probably damaging	0.96
maniac	UTSW	1	67157878	critical splice donor site	probably null
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0140:Cps1	UTSW	1	67180116	missense	probably benign
R0318:Cps1	UTSW	1	67177014	missense	probably damaging	0.99
R0486:Cps1	UTSW	1	67165392	missense	probably damaging	1.00
R0488:Cps1	UTSW	1	67148808	splice site	probably benign
R0492:Cps1	UTSW	1	67157836	missense	probably damaging	1.00
R0521:Cps1	UTSW	1	67215564	missense	probably benign	0.02
R0534:Cps1	UTSW	1	67143900	missense	probably benign	0.06
R0565:Cps1	UTSW	1	67166449	missense	possibly damaging	0.57
R0609:Cps1	UTSW	1	67172802	missense	probably damaging	1.00
R0612:Cps1	UTSW	1	67139770	missense	probably benign	0.01
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1220:Cps1	UTSW	1	67204703	critical splice donor site	probably null
R1321:Cps1	UTSW	1	67143019	splice site	probably benign
R1343:Cps1	UTSW	1	67209609	missense	probably damaging	1.00
R1373:Cps1	UTSW	1	67229424	missense	possibly damaging	0.89
R1374:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1481:Cps1	UTSW	1	67143882	missense	probably damaging	0.99
R1711:Cps1	UTSW	1	67168374	splice site	probably null
R1712:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1774:Cps1	UTSW	1	67170882	missense	possibly damaging	0.94
R1799:Cps1	UTSW	1	67209642	missense	probably damaging	1.00
R1954:Cps1	UTSW	1	67195196	missense	possibly damaging	0.71
R2074:Cps1	UTSW	1	67204638	missense	probably benign	0.21
R2078:Cps1	UTSW	1	67157806	missense	probably damaging	1.00
R2078:Cps1	UTSW	1	67195265	missense	possibly damaging	0.74
R2111:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2112:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2146:Cps1	UTSW	1	67152379	splice site	probably benign
R2355:Cps1	UTSW	1	67156224	missense	probably damaging	1.00
R2375:Cps1	UTSW	1	67217860	missense	probably benign	0.00
R2860:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2861:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2979:Cps1	UTSW	1	67204704	critical splice donor site	probably null
R3427:Cps1	UTSW	1	67174494	missense	probably damaging	1.00
R3833:Cps1	UTSW	1	67139787	missense	probably damaging	1.00
R3857:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3858:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3859:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3886:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3887:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3888:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3889:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R4386:Cps1	UTSW	1	67170995	critical splice donor site	probably null
R4497:Cps1	UTSW	1	67205199	missense	probably null	1.00
R4671:Cps1	UTSW	1	67196560	missense	probably damaging	1.00
R4774:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R4799:Cps1	UTSW	1	67142986	missense	probably damaging	0.96
R4853:Cps1	UTSW	1	67156202	missense	possibly damaging	0.51
R4884:Cps1	UTSW	1	67177024	missense	probably benign	0.11
R4900:Cps1	UTSW	1	67160904	missense	probably damaging	1.00
R4906:Cps1	UTSW	1	67139763	missense	probably benign	0.10
R5091:Cps1	UTSW	1	67229520	critical splice donor site	probably null
R5102:Cps1	UTSW	1	67206793	missense	probably benign	0.00
R5290:Cps1	UTSW	1	67172709	missense	probably benign	0.21
R5732:Cps1	UTSW	1	67157764	missense	probably benign	0.22
R5818:Cps1	UTSW	1	67166488	missense	possibly damaging	0.96
R5878:Cps1	UTSW	1	67157878	critical splice donor site	probably null
R6002:Cps1	UTSW	1	67172755	missense	possibly damaging	0.94
R6034:Cps1	UTSW	1	67157713	intron	probably null
R6034:Cps1	UTSW	1	67157713	intron	probably null
R6199:Cps1	UTSW	1	67162615	frame shift	probably null
R6310:Cps1	UTSW	1	67142981	missense	probably benign	0.00
R6554:Cps1	UTSW	1	67174469	nonsense	probably null
R6700:Cps1	UTSW	1	67229523	splice site	probably null
R6731:Cps1	UTSW	1	67160871	missense	probably damaging	0.96
R7052:Cps1	UTSW	1	67198410	missense	probably damaging	1.00
R7278:Cps1	UTSW	1	67170921	missense	probably damaging	1.00
R7313:Cps1	UTSW	1	67198358	missense	probably damaging	0.99
R7323:Cps1	UTSW	1	67157869	missense	probably benign	0.03
R7339:Cps1	UTSW	1	67197015	missense	possibly damaging	0.64
R7485:Cps1	UTSW	1	67139857	missense	probably damaging	1.00
R7505:Cps1	UTSW	1	67180081	missense	probably benign
R7748:Cps1	UTSW	1	67139806	missense	probably damaging	1.00
R7853:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
R7936:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
X0024:Cps1	UTSW	1	67123247	missense	probably benign
Z1176:Cps1	UTSW	1	67123268	missense	possibly damaging	0.54
Z1176:Cps1	UTSW	1	67148719	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTGGTGTCTCCTTGAATGCAATTTC -3'
(R):5'- TGTGCCCATCTCCCAAGAAC -3'

Sequencing Primer
(F):5'- CTGCATGATCAGTCAAGTGC -3'
(R):5'- ACAAAGTGCCTTACTGATTCCACTG -3'

Posted On

2016-07-22