Incidental Mutation 'R5215:Cps1'
ID403384
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67166380 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 521 (F521I)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027144
AA Change: F521I

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: F521I

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGGTGTCTCCTTGAATGCAATTTC -3'
(R):5'- TGTGCCCATCTCCCAAGAAC -3'

Sequencing Primer
(F):5'- CTGCATGATCAGTCAAGTGC -3'
(R):5'- ACAAAGTGCCTTACTGATTCCACTG -3'
Posted On2016-07-22