Incidental Mutation 'R5215:Atic'
ID403385
Institutional Source Beutler Lab
Gene Symbol Atic
Ensembl Gene ENSMUSG00000026192
Gene Name5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms2610509C24Rik
MMRRC Submission 042788-MU
Accession Numbers

Genbank: NM_026195; MGI: 1351352

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location71557150-71579631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71564507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 161 (S161P)
Ref Sequence ENSEMBL: ENSMUSP00000027384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027384]
Predicted Effect probably damaging
Transcript: ENSMUST00000027384
AA Change: S161P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027384
Gene: ENSMUSG00000026192
AA Change: S161P

DomainStartEndE-ValueType
MGS 16 130 1.31e-46 SMART
AICARFT_IMPCHas 135 462 4.84e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187982
Meta Mutation Damage Score 0.3846 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Atic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Atic APN 1 71570837 splice site probably benign
IGL02368:Atic APN 1 71564565 splice site probably benign
IGL03291:Atic APN 1 71570922 missense probably benign 0.06
3-1:Atic UTSW 1 71560895 nonsense probably null
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0558:Atic UTSW 1 71563788 missense probably benign 0.00
R1222:Atic UTSW 1 71559279 missense probably damaging 1.00
R1662:Atic UTSW 1 71576127 missense probably benign 0.06
R2075:Atic UTSW 1 71576127 missense probably benign 0.06
R2402:Atic UTSW 1 71569057 nonsense probably null
R2475:Atic UTSW 1 71559269 missense probably damaging 1.00
R2566:Atic UTSW 1 71568971 missense probably damaging 0.98
R3711:Atic UTSW 1 71578579 missense probably benign 0.02
R5115:Atic UTSW 1 71557275 critical splice donor site probably null
R5444:Atic UTSW 1 71576717 missense probably damaging 0.96
R6348:Atic UTSW 1 71576698 missense probably damaging 1.00
R6370:Atic UTSW 1 71578660 missense probably damaging 1.00
R6374:Atic UTSW 1 71564941 missense probably damaging 1.00
R6909:Atic UTSW 1 71576846 intron probably null
R7224:Atic UTSW 1 71570855 missense probably benign
R7444:Atic UTSW 1 71563787 missense probably benign 0.05
R7724:Atic UTSW 1 71564901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGGGAATTCCGATGAGC -3'
(R):5'- TTTAGGTACAGCCTCAGCCG -3'

Sequencing Primer
(F):5'- AAGGGGAATTCCGATGAGCTATTTTC -3'
(R):5'- CTCTGTGTTCAATGAAAGGACAG -3'
Posted On2016-07-22