Incidental Mutation 'R5215:Chd6'
ID403395
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 160949953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2495 (V2495M)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: V2495M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: V2495M

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense not run
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCTTGCAAGAGACGCTG -3'
(R):5'- TTCAATCACACCCTAGCTGAG -3'

Sequencing Primer
(F):5'- ACGCTGAAGCAGTGGTC -3'
(R):5'- ACACCCTAGCTGAGCCTGTG -3'
Posted On2016-07-22