Incidental Mutation 'R5215:Kcng1'
ID403397
Institutional Source Beutler Lab
Gene Symbol Kcng1
Ensembl Gene ENSMUSG00000074575
Gene Namepotassium voltage-gated channel, subfamily G, member 1
SynonymsOTTMUSG00000016048
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168260117-168281736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168263133 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 264 (M264I)
Ref Sequence ENSEMBL: ENSMUSP00000104815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099069] [ENSMUST00000109191]
Predicted Effect probably benign
Transcript: ENSMUST00000099069
AA Change: M264I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096668
Gene: ENSMUSG00000074575
AA Change: M264I

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 226 470 8.6e-41 PFAM
Pfam:Ion_trans_2 379 465 7.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109191
AA Change: M264I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104815
Gene: ENSMUSG00000074575
AA Change: M264I

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 270 459 1.9e-31 PFAM
Pfam:Ion_trans_2 379 465 1e-15 PFAM
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This gene is abundantly expressed in skeletal muscle. Multiple alternatively spliced transcript variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Kcng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Kcng1 APN 2 168268764 missense probably benign
IGL01316:Kcng1 APN 2 168269040 missense probably damaging 1.00
PIT4378001:Kcng1 UTSW 2 168262684 missense probably damaging 0.98
R0104:Kcng1 UTSW 2 168269046 missense probably damaging 1.00
R0692:Kcng1 UTSW 2 168262763 missense probably damaging 0.99
R1574:Kcng1 UTSW 2 168269041 missense probably damaging 1.00
R1574:Kcng1 UTSW 2 168269041 missense probably damaging 1.00
R1591:Kcng1 UTSW 2 168268710 missense possibly damaging 0.76
R1731:Kcng1 UTSW 2 168268689 missense probably benign 0.00
R1937:Kcng1 UTSW 2 168263021 missense probably benign 0.02
R1960:Kcng1 UTSW 2 168262984 missense probably benign 0.03
R2145:Kcng1 UTSW 2 168269032 missense probably damaging 1.00
R4167:Kcng1 UTSW 2 168262697 missense probably damaging 1.00
R5816:Kcng1 UTSW 2 168268723 missense possibly damaging 0.90
R6367:Kcng1 UTSW 2 168262652 missense probably damaging 1.00
R7058:Kcng1 UTSW 2 168262609 missense probably damaging 1.00
X0063:Kcng1 UTSW 2 168269073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTCCAGGTAGCTGTTGC -3'
(R):5'- CTGGGTTAAAGCGGAAGTTG -3'

Sequencing Primer
(F):5'- AGCTGTTGCCGGTGCTC -3'
(R):5'- TTGAGAGAACAGGAGCTTGG -3'
Posted On2016-07-22