Incidental Mutation 'R5215:Vmn2r9'
ID403406
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108846485 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 433 (S433P)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably benign
Transcript: ENSMUST00000170419
AA Change: S433P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: S433P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1704:Vmn2r9 UTSW 5 108846400 missense probably damaging 1.00
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3852:Vmn2r9 UTSW 5 108848131 missense probably damaging 1.00
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3905:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4477:Vmn2r9 UTSW 5 108846277 missense probably benign
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6137:Vmn2r9 UTSW 5 108849016 missense probably benign 0.00
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGCCCAGTCCAAATC -3'
(R):5'- ACAGACATTCAGACTTCCCTTC -3'

Sequencing Primer
(F):5'- GTGGCCCAGTCCAAATCTTCAG -3'
(R):5'- CTTTTGATGAACATGCATACACACAC -3'
Posted On2016-07-22