Incidental Mutation 'R5215:Pan3'
ID403408
Institutional Source Beutler Lab
Gene Symbol Pan3
Ensembl Gene ENSMUSG00000029647
Gene NamePAN3 poly(A) specific ribonuclease subunit
Synonyms2700050F09Rik, A430027N15Rik
MMRRC Submission 042788-MU
Accession Numbers

Genbank: NM_028291.4; Ensembl: ENSMUST00000031651

Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147430161-147548502 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 147455105 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031651] [ENSMUST00000031651] [ENSMUST00000176600] [ENSMUST00000176600]
Predicted Effect probably null
Transcript: ENSMUST00000031651
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000031651
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176357
Predicted Effect probably benign
Transcript: ENSMUST00000176466
Predicted Effect probably benign
Transcript: ENSMUST00000176596
Predicted Effect probably null
Transcript: ENSMUST00000176600
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176600
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176753
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176753
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177327
Predicted Effect probably benign
Transcript: ENSMUST00000177465
SMART Domains Protein: ENSMUSP00000134810
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200885
Predicted Effect probably null
Transcript: ENSMUST00000200885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202884
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
Allele List at MGI

 All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Pan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Pan3 APN 5 147529973 missense probably benign 0.05
IGL01612:Pan3 APN 5 147453242 splice site probably benign
IGL02187:Pan3 APN 5 147526588 missense probably benign 0.21
IGL02324:Pan3 APN 5 147530123 splice site probably null
IGL02328:Pan3 APN 5 147530123 splice site probably null
IGL02507:Pan3 APN 5 147526596 missense probably damaging 0.98
IGL03144:Pan3 APN 5 147450781 splice site probably benign
3-1:Pan3 UTSW 5 147526575 missense probably benign 0.14
R2145:Pan3 UTSW 5 147530098 missense possibly damaging 0.87
R2174:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R2504:Pan3 UTSW 5 147527036 missense possibly damaging 0.87
R3106:Pan3 UTSW 5 147539379 splice site probably benign
R3723:Pan3 UTSW 5 147503208 intron probably benign
R3944:Pan3 UTSW 5 147450730 missense probably damaging 1.00
R4589:Pan3 UTSW 5 147543173 missense probably damaging 0.98
R4647:Pan3 UTSW 5 147527203 missense probably damaging 1.00
R4811:Pan3 UTSW 5 147530058 missense probably damaging 1.00
R5001:Pan3 UTSW 5 147526682 critical splice donor site probably null
R5126:Pan3 UTSW 5 147527198 missense probably benign 0.00
R5317:Pan3 UTSW 5 147543210 critical splice donor site probably null
R5496:Pan3 UTSW 5 147527128 critical splice acceptor site probably null
R5687:Pan3 UTSW 5 147455172 missense probably damaging 1.00
R6147:Pan3 UTSW 5 147548283 unclassified probably benign
R6539:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R7008:Pan3 UTSW 5 147545693 missense probably damaging 0.99
R7047:Pan3 UTSW 5 147546365 missense probably damaging 0.97
R7226:Pan3 UTSW 5 147526992 missense probably damaging 1.00
R7424:Pan3 UTSW 5 147536272 intron probably null
R7453:Pan3 UTSW 5 147526681 critical splice donor site probably null
R8062:Pan3 UTSW 5 147527150 missense probably benign 0.18
X0060:Pan3 UTSW 5 147543133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAGATGCTTTCTCACATAGAGG -3'
(R):5'- CATAAAGGTCTTCCTCCCACTGAG -3'

Sequencing Primer
(F):5'- CACATAGAGGTATATACTTGGCTGG -3'
(R):5'- CCCACTGAGGAAAATGTTGGTTACC -3'
Posted On2016-07-22