Incidental Mutation 'R5215:Olfr521'
ID403416
Institutional Source Beutler Lab
Gene Symbol Olfr521
Ensembl Gene ENSMUSG00000073997
Gene Nameolfactory receptor 521
SynonymsMOR101-2, GA_x6K02T2PBJ9-2443810-2444775
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99763507-99769321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99767510 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 116 (E116G)
Ref Sequence ENSEMBL: ENSMUSP00000151473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098263] [ENSMUST00000219663] [ENSMUST00000220001]
Predicted Effect probably damaging
Transcript: ENSMUST00000098263
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095863
Gene: ENSMUSG00000073997
AA Change: E116G

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.4e-63 PFAM
Pfam:7TM_GPCR_Srsx 40 310 7.4e-6 PFAM
Pfam:7tm_1 46 309 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219663
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000220001
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Olfr521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Olfr521 APN 7 99767972 missense possibly damaging 0.73
IGL02491:Olfr521 APN 7 99767333 missense possibly damaging 0.85
R0544:Olfr521 UTSW 7 99767660 missense probably benign
R1029:Olfr521 UTSW 7 99767224 missense probably benign 0.01
R1840:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R4709:Olfr521 UTSW 7 99767782 missense probably damaging 1.00
R5752:Olfr521 UTSW 7 99767948 missense probably benign 0.00
R5934:Olfr521 UTSW 7 99767389 missense probably damaging 1.00
R6913:Olfr521 UTSW 7 99767717 missense probably damaging 1.00
R7394:Olfr521 UTSW 7 99767346 missense probably damaging 1.00
R7554:Olfr521 UTSW 7 99768003 missense possibly damaging 0.62
Z1177:Olfr521 UTSW 7 99767914 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCACAAGCCCATGTACTTC -3'
(R):5'- TGCAGAAGCCCATGAGTGTC -3'

Sequencing Primer
(F):5'- AGCCCATGTACTTCTTCCTAATCAAC -3'
(R):5'- CAATGTTGTCAAACGCCATCTGG -3'
Posted On2016-07-22