Mutagenetix > Incidental Mutations

Incidental Mutation 'R0416:Cmya5'

40343

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

038618-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.262) question?

Stock #

R0416 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 93089856 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 2908 (N2908T)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

Predicted Effect

probably benign
Transcript: ENSMUST00000062122
AA Change: N2908T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: N2908T

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224009

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.2%
20x: 91.8%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	A	G	7: 119,563,556	I18V	probably benign	Het
Adamdec1	T	G	14: 68,568,712	E438A	possibly damaging	Het
Adamts17	A	G	7: 66,915,898		probably null	Het
Ankrd44	T	G	1: 54,743,339	I359L	possibly damaging	Het
Ap2s1	C	A	7: 16,747,365	N86K	probably damaging	Het
Arih1	T	A	9: 59,426,710		probably benign	Het
Astn1	T	A	1: 158,509,891	I389N	probably damaging	Het
Brca2	T	C	5: 150,569,392	S3291P	possibly damaging	Het
Cacna1d	T	C	14: 30,100,688		probably benign	Het
Ccl7	C	A	11: 82,045,866		probably benign	Het
Cd74	A	T	18: 60,811,414	Y232F	possibly damaging	Het
Cep128	A	G	12: 91,230,867		probably benign	Het
Cep89	T	A	7: 35,416,402		probably benign	Het
Coil	T	C	11: 88,981,986	L391S	possibly damaging	Het
Cpd	C	T	11: 76,785,204	V1208I	probably benign	Het
Ddx19a	T	C	8: 110,979,057	D254G	probably damaging	Het
Desi2	T	A	1: 178,256,321		probably benign	Het
Dnah11	A	T	12: 117,911,058	M4024K	probably damaging	Het
Ergic2	A	T	6: 148,183,144	L53H	probably damaging	Het
Etv2	T	C	7: 30,634,633	Y225C	probably benign	Het
F10	G	A	8: 13,055,448	A338T	probably damaging	Het
Fam228b	T	A	12: 4,762,382	D132V	probably damaging	Het
Fat2	T	A	11: 55,284,134	I1918F	possibly damaging	Het
Fbxw5	C	T	2: 25,503,239	S214F	probably damaging	Het
Glyat	G	A	19: 12,651,453	R204Q	possibly damaging	Het
Gm4825	T	C	15: 85,510,981		noncoding transcript	Het
Ino80d	G	T	1: 63,086,276	T9K	possibly damaging	Het
Lifr	A	T	15: 7,166,914	D193V	probably damaging	Het
Lrp12	G	T	15: 39,878,911		probably benign	Het
Lrp3	A	G	7: 35,202,353	V701A	probably benign	Het
Mfsd11	T	A	11: 116,865,882		probably benign	Het
Mrto4	A	T	4: 139,349,732		probably null	Het
Msi1	T	C	5: 115,430,649	F43L	possibly damaging	Het
Mthfsd	T	C	8: 121,101,237	D168G	probably damaging	Het
Myo15	T	A	11: 60,511,174	V3099E	probably damaging	Het
Myrf	T	C	19: 10,215,812		probably null	Het
Nadk	C	A	4: 155,587,799		probably benign	Het
Nav1	T	C	1: 135,471,126	K573E	possibly damaging	Het
Ndufs3	A	G	2: 90,898,388	V207A	probably damaging	Het
Nlrp3	T	C	11: 59,555,924		probably benign	Het
Nlrx1	T	G	9: 44,262,914	D330A	probably benign	Het
Olfr331	T	C	11: 58,502,396	I53M	unknown	Het
Olfr444	G	A	6: 42,955,570	C24Y	probably benign	Het
Osbpl3	C	T	6: 50,348,018	V167I	probably benign	Het
Pcnx	A	T	12: 81,974,466	I1410F	probably benign	Het
Piezo2	G	A	18: 63,024,491	R2383C	probably damaging	Het
Pip5kl1	A	T	2: 32,583,424	K358*	probably null	Het
Polg	T	C	7: 79,452,240		probably benign	Het
Prr14l	T	A	5: 32,828,717	I1145F	probably benign	Het
Psmb1	C	T	17: 15,494,519	V39I	probably benign	Het
Ptk6	T	C	2: 181,202,308	Y66C	possibly damaging	Het
Robo4	T	C	9: 37,404,766		probably benign	Het
Sdk2	A	G	11: 113,803,203	Y1801H	probably damaging	Het
Serpinb3a	C	A	1: 107,049,386	A95S	probably benign	Het
Setd1a	CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	7: 127,785,297		probably benign	Het
Sik2	A	T	9: 50,995,632	Y98N	probably damaging	Het
Slc30a1	C	T	1: 191,909,726	P495S	probably benign	Het
Smg1	A	T	7: 118,184,461		probably benign	Het
Stk3	T	A	15: 35,114,632	I45L	probably benign	Het
Tapbp	A	G	17: 33,925,418	T163A	probably damaging	Het
Tdrd5	T	C	1: 156,285,481	K410E	probably damaging	Het
Trim30b	A	T	7: 104,363,766	M152K	probably benign	Het
Trpm6	G	T	19: 18,783,025		probably benign	Het
Tsc22d1	T	C	14: 76,505,303		probably benign	Het
U2surp	A	T	9: 95,485,607	F444I	probably damaging	Het
Vmn2r95	C	T	17: 18,441,402	P470L	probably damaging	Het
Zc3h4	T	G	7: 16,420,275	Y163D	probably damaging	Het
Zfp62	A	T	11: 49,215,676	H198L	probably damaging	Het
Zmym1	A	G	4: 127,058,820	L56P	probably benign	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7961:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7975:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	not run
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTTGGCTCACTCTCCAGAACAC -3'
(R):5'- TTCCCAAGGCGACATTCTGACAC -3'

Sequencing Primer
(F):5'- TCTCCAGAACACAGCGGG -3'
(R):5'- GCGACATTCTGACACTGATG -3'

Posted On

2013-05-23