Incidental Mutation 'R5215:Atp6v1c2'
ID403436
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17291658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 244 (E244G)
Ref Sequence ENSEMBL: ENSMUSP00000020884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000156727] [ENSMUST00000221129]
Predicted Effect probably benign
Transcript: ENSMUST00000020884
AA Change: E244G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566
AA Change: E244G

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095820
AA Change: E234G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566
AA Change: E234G

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140751
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156727
AA Change: E164G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566
AA Change: E164G

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221129
AA Change: E234G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1751 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0358:Atp6v1c2 UTSW 12 17284960 splice site probably benign
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R0536:Atp6v1c2 UTSW 12 17307508 splice site probably null
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4695:Atp6v1c2 UTSW 12 17301207 missense probably benign 0.02
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6196:Atp6v1c2 UTSW 12 17301186 nonsense probably null
R7059:Atp6v1c2 UTSW 12 17289004 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCAACCTGGTCATCTCCTC -3'
(R):5'- AAGGCTGAAGCATATGCCACC -3'

Sequencing Primer
(F):5'- AACCTGGTCATCTCCTCCCTTTC -3'
(R):5'- AGGCCCATGGAACCTGGTTG -3'
Posted On2016-07-22