Incidental Mutation 'R5215:Cdc45'
ID403448
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18795897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
Predicted Effect probably damaging
Transcript: ENSMUST00000000028
AA Change: R251H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: R251H

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096990
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: R205H

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Meta Mutation Damage Score 0.1932 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Glmn A G 5: 107,561,886 C351R probably benign Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
R7910:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
R7991:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACATGGGTGGTTCTATCAC -3'
(R):5'- TGACTGTGTGGGCTAGACAC -3'

Sequencing Primer
(F):5'- GGTTCTATCACCATAGTAACGAAAC -3'
(R):5'- TATCTCAGTACCTAAAGATGGGGC -3'
Posted On2016-07-22