Mutagenetix > Incidental Mutations

Incidental Mutation 'R5215:Taf6l'

403456

Institutional Source

Beutler Lab

Gene Symbol

Taf6l

Ensembl Gene

ENSMUSG00000003680

Gene Name

TATA-box binding protein associated factor 6 like

Synonyms

PAF65A, 2810417N14Rik, C530024J06Rik

MMRRC Submission

042788-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R5215 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8772522-8786417 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 8778053 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]

Predicted Effect

probably benign
Transcript: ENSMUST00000003777

SMART Domains

Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	16	79	9.03e-28	SMART
Pfam:DUF1546	248	339	4.5e-29	PFAM
low complexity region	565	576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000010249

SMART Domains

Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	45	62	N/A	INTRINSIC
transmembrane domain	64	86	N/A	INTRINSIC
transmembrane domain	98	120	N/A	INTRINSIC
low complexity region	173	182	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176331

Predicted Effect

probably benign
Transcript: ENSMUST00000176496

SMART Domains

Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	224	315	4.3e-29	PFAM
low complexity region	541	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176610

SMART Domains

Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:TAF6_C	249	338	6.6e-22	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176719

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176747

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176991

Predicted Effect

probably benign
Transcript: ENSMUST00000177056

SMART Domains

Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	10	73	9.03e-28	SMART
Pfam:DUF1546	242	333	4.5e-29	PFAM
low complexity region	559	570	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177216

SMART Domains

Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	249	340	6.4e-29	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189739

SMART Domains

Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
TAF	16	79	3.8e-31	SMART
Pfam:DUF1546	223	314	6.3e-26	PFAM
low complexity region	540	551	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alas1	C	A	9: 106,243,375	A73S	probably benign	Het
Aldoart2	G	A	12: 55,565,419	R43Q	probably benign	Het
Ano4	T	C	10: 89,317,303	H49R	possibly damaging	Het
Atic	T	C	1: 71,564,507	S161P	probably damaging	Het
Atp6v1c2	T	C	12: 17,291,658	E244G	probably benign	Het
Cd164l2	C	A	4: 133,221,478	L42I	unknown	Het
Cdc42ep2	T	C	19: 5,918,210	R156G	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdk5	T	A	5: 24,419,461	N265I	probably benign	Het
Cfap69	G	T	5: 5,589,133	N262K	possibly damaging	Het
Chd6	C	T	2: 160,949,953	V2495M	probably damaging	Het
Cps1	T	A	1: 67,166,380	F521I	possibly damaging	Het
Crb2	A	G	2: 37,793,753	E1089G	probably benign	Het
Decr1	T	C	4: 15,929,795	D166G	probably damaging	Het
Dhodh	G	A	8: 109,606,343		probably benign	Het
Dnaaf5	G	A	5: 139,161,877	V399I	probably benign	Het
Dnah11	T	C	12: 118,157,361	T526A	probably benign	Het
Drosha	T	C	15: 12,885,133		probably benign	Het
Elfn2	T	A	15: 78,674,201	I49F	probably damaging	Het
Gabra1	T	C	11: 42,154,828	T152A	probably damaging	Het
Gigyf2	C	A	1: 87,365,266	T85K	probably damaging	Het
Gimap8	A	T	6: 48,651,083	Y258F	possibly damaging	Het
Glmn	A	G	5: 107,561,886	C351R	probably benign	Het
Gm10032	T	C	14: 66,792,549		noncoding transcript	Het
Gm340	T	C	19: 41,585,932	I1042T	probably damaging	Het
Gorasp2	G	A	2: 70,689,254	A328T	probably benign	Het
Grin1	A	T	2: 25,303,907	H392Q	probably benign	Het
Gzmn	A	G	14: 56,167,862	V55A	probably damaging	Het
Herc4	T	A	10: 63,289,097	S497T	probably benign	Het
Hrc	A	T	7: 45,336,091	D222V	probably damaging	Het
Iars2	T	C	1: 185,294,769	H761R	probably damaging	Het
Jmjd1c	T	A	10: 67,240,701	D2101E	possibly damaging	Het
Kcng1	C	T	2: 168,263,133	M264I	probably benign	Het
Klra14-ps	C	A	6: 130,157,683		noncoding transcript	Het
Krtap5-3	T	A	7: 142,202,237	C270*	probably null	Het
Lama3	A	G	18: 12,577,900	H3164R	probably damaging	Het
Mdn1	T	C	4: 32,741,418	M3840T	possibly damaging	Het
Mtor	A	T	4: 148,453,983	H166L	probably benign	Het
Mx1	T	C	16: 97,448,360	N556D	possibly damaging	Het
Oca2	A	T	7: 56,295,498	R285*	probably null	Het
Olfr103	T	A	17: 37,336,813	I140F	probably benign	Het
Olfr1285	T	C	2: 111,409,286		noncoding transcript	Het
Olfr521	A	G	7: 99,767,510	E116G	probably damaging	Het
Olfr681	G	A	7: 105,126,564	H246Y	probably damaging	Het
Olfr952	A	T	9: 39,426,623	Y149*	probably null	Het
Pan3	A	G	5: 147,455,105		probably null	Het
Pard3	G	A	8: 127,378,264	V496M	probably damaging	Het
Pdcd2l	A	T	7: 34,192,889	V185D	possibly damaging	Het
Pgghg	T	C	7: 140,946,564	V623A	possibly damaging	Het
Pigu	C	A	2: 155,335,329		probably benign	Het
Pkmyt1	G	A	17: 23,732,592	R40Q	probably benign	Het
Prag1	G	A	8: 36,099,889	A65T	probably benign	Het
Prkdc	C	A	16: 15,772,121	T2616N	possibly damaging	Het
Prpf8	G	A	11: 75,500,204	E1360K	probably benign	Het
Ptprt	C	T	2: 162,278,164	V128M	probably damaging	Het
Rp1l1	C	T	14: 64,030,013	S1016L	probably benign	Het
Rprd1a	G	T	18: 24,488,200	D307E	probably damaging	Het
Slc11a1	A	T	1: 74,383,777		probably benign	Het
Slc22a16	T	A	10: 40,581,390	M209K	probably damaging	Het
Slf2	T	G	19: 44,948,037	L707R	probably damaging	Het
Son	T	A	16: 91,656,675	M770K	probably damaging	Het
Tbc1d2	C	A	4: 46,614,006	V692L	probably benign	Het
Tnpo3	C	T	6: 29,582,153		probably benign	Het
Txndc16	A	T	14: 45,211,140		probably benign	Het
Ubr1	T	C	2: 120,904,044	K1125R	probably benign	Het
Vmn2r9	A	G	5: 108,846,485	S433P	probably benign	Het
Zc3h12a	A	G	4: 125,126,913	S46P	probably benign	Het
Zwilch	T	G	9: 64,146,874	I490L	probably benign	Het

Other mutations in Taf6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Taf6l	APN	19	8783388	missense	probably benign	0.04
IGL00781:Taf6l	APN	19	8773661	missense	probably damaging	1.00
IGL01886:Taf6l	APN	19	8778086	critical splice donor site	probably null
IGL02638:Taf6l	APN	19	8775266	missense	probably benign	0.03
IGL02676:Taf6l	APN	19	8775049	missense	probably damaging	1.00
R0096:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R0110:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0469:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0510:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0676:Taf6l	UTSW	19	8773369	missense	probably benign	0.00
R0711:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R1804:Taf6l	UTSW	19	8773634	missense	probably damaging	0.99
R1971:Taf6l	UTSW	19	8775502	splice site	probably null
R2869:Taf6l	UTSW	19	8778628	unclassified	probably benign
R2870:Taf6l	UTSW	19	8778628	unclassified	probably benign
R3105:Taf6l	UTSW	19	8778855	missense	probably damaging	1.00
R4578:Taf6l	UTSW	19	8783971	missense	possibly damaging	0.95
R4581:Taf6l	UTSW	19	8778208	missense	probably damaging	0.99
R4841:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R4842:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R5269:Taf6l	UTSW	19	8774962	missense	probably damaging	1.00
R5571:Taf6l	UTSW	19	8783930	missense	probably damaging	1.00
R5687:Taf6l	UTSW	19	8773312	missense	probably benign	0.01
R5799:Taf6l	UTSW	19	8782631	missense	possibly damaging	0.93
R5814:Taf6l	UTSW	19	8774846	missense	probably benign	0.13
R6008:Taf6l	UTSW	19	8778166	missense	possibly damaging	0.65
R6091:Taf6l	UTSW	19	8778556	missense	probably benign	0.04
R6228:Taf6l	UTSW	19	8778666	missense	probably benign	0.01
R6569:Taf6l	UTSW	19	8772710	missense	probably damaging	1.00
R6768:Taf6l	UTSW	19	8774549	missense	probably damaging	1.00
R7586:Taf6l	UTSW	19	8783846	missense	probably damaging	0.99
R8282:Taf6l	UTSW	19	8773350	missense	possibly damaging	0.95
Z1176:Taf6l	UTSW	19	8782544	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- TCACAAACTGATGAAGGCCGG -3'
(R):5'- ACTGTTGCTTCCACAGGACG -3'

Sequencing Primer
(F):5'- GGGTTATATAACAAGCACTGCCTC -3'
(R):5'- CGCATGGAGACCTTGTAAGTG -3'

Posted On

2016-07-22