Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:Klhl20'

403461

Institutional Source

Beutler Lab

Gene Symbol

Klhl20

Ensembl Gene

ENSMUSG00000026705

Gene Name

kelch-like 20

Synonyms

D930050H05Rik

MMRRC Submission

042789-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

161088375-161131511 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 161093679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]

AlphaFold

Q8VCK5

Predicted Effect

probably null
Transcript: ENSMUST00000111611

SMART Domains

Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117467

SMART Domains

Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140905

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148952

Predicted Effect

probably benign
Transcript: ENSMUST00000195584

SMART Domains

Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705

Domain	Start	End	E-Value	Type
Kelch	1	40	1.43e-4	SMART
Kelch	41	87	1.59e-11	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Klhl20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Klhl20	APN	1	161109755	missense	probably benign	0.00
IGL00903:Klhl20	APN	1	161090506	missense	probably benign	0.00
IGL01574:Klhl20	APN	1	161093726	missense	probably damaging	1.00
IGL01721:Klhl20	APN	1	161095587	missense	probably damaging	1.00
IGL01933:Klhl20	APN	1	161106787	missense	probably damaging	1.00
IGL02187:Klhl20	APN	1	161109710	missense	probably benign	0.05
IGL02634:Klhl20	APN	1	161098365	missense	probably damaging	0.98
IGL02691:Klhl20	APN	1	161106874	splice site	probably benign
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0639:Klhl20	UTSW	1	161093711	missense	probably damaging	1.00
R1730:Klhl20	UTSW	1	161102990	missense	possibly damaging	0.82
R1856:Klhl20	UTSW	1	161106742	missense	probably benign	0.00
R2016:Klhl20	UTSW	1	161103038	missense	probably damaging	0.98
R2901:Klhl20	UTSW	1	161109552	nonsense	probably null
R4822:Klhl20	UTSW	1	161093763	nonsense	probably null
R4830:Klhl20	UTSW	1	161098376	missense	probably benign	0.00
R4894:Klhl20	UTSW	1	161109532	missense	possibly damaging	0.76
R4981:Klhl20	UTSW	1	161103005	missense	possibly damaging	0.48
R5018:Klhl20	UTSW	1	161101586	missense	probably damaging	0.98
R5023:Klhl20	UTSW	1	161109220	critical splice donor site	probably null
R5108:Klhl20	UTSW	1	161099250	missense	probably damaging	0.99
R5659:Klhl20	UTSW	1	161090470	missense	probably damaging	1.00
R6159:Klhl20	UTSW	1	161105467	missense	probably damaging	1.00
R6836:Klhl20	UTSW	1	161105406	missense	probably benign	0.18
R6914:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6915:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6920:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R7706:Klhl20	UTSW	1	161109257	missense	probably benign	0.01
R7976:Klhl20	UTSW	1	161106737	missense	probably benign	0.02
R7991:Klhl20	UTSW	1	161106864	missense	possibly damaging	0.89
R8085:Klhl20	UTSW	1	161093784	missense	probably damaging	1.00
R8118:Klhl20	UTSW	1	161098401	splice site	probably null
R8204:Klhl20	UTSW	1	161106844	missense	probably benign	0.04
R8678:Klhl20	UTSW	1	161109427	missense	probably damaging	1.00
R9093:Klhl20	UTSW	1	161095661	nonsense	probably null
R9094:Klhl20	UTSW	1	161105485	missense	probably damaging	1.00
R9360:Klhl20	UTSW	1	161093699	missense	probably benign	0.06
R9532:Klhl20	UTSW	1	161109759	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCCCAGCAGGATATGACG -3'
(R):5'- CCTAGAGACTGTGAATTCCCC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- TGTGAATTCCCCGCGGC -3'

Posted On

2016-07-22