Incidental Mutation 'R5216:Klhl20'
ID403461
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Namekelch-like 20
SynonymsD930050H05Rik
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161088375-161131511 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 161093679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]
Predicted Effect probably null
Transcript: ENSMUST00000111611
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117467
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148952
Predicted Effect probably benign
Transcript: ENSMUST00000195584
SMART Domains Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705

DomainStartEndE-ValueType
Kelch 1 40 1.43e-4 SMART
Kelch 41 87 1.59e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 161109755 missense probably benign 0.00
IGL00903:Klhl20 APN 1 161090506 missense probably benign 0.00
IGL01574:Klhl20 APN 1 161093726 missense probably damaging 1.00
IGL01721:Klhl20 APN 1 161095587 missense probably damaging 1.00
IGL01933:Klhl20 APN 1 161106787 missense probably damaging 1.00
IGL02187:Klhl20 APN 1 161109710 missense probably benign 0.05
IGL02634:Klhl20 APN 1 161098365 missense probably damaging 0.98
IGL02691:Klhl20 APN 1 161106874 splice site probably benign
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0639:Klhl20 UTSW 1 161093711 missense probably damaging 1.00
R1730:Klhl20 UTSW 1 161102990 missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 161106742 missense probably benign 0.00
R2016:Klhl20 UTSW 1 161103038 missense probably damaging 0.98
R2901:Klhl20 UTSW 1 161109552 nonsense probably null
R4822:Klhl20 UTSW 1 161093763 nonsense probably null
R4830:Klhl20 UTSW 1 161098376 missense probably benign 0.00
R4894:Klhl20 UTSW 1 161109532 missense possibly damaging 0.76
R4981:Klhl20 UTSW 1 161103005 missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 161101586 missense probably damaging 0.98
R5023:Klhl20 UTSW 1 161109220 critical splice donor site probably null
R5108:Klhl20 UTSW 1 161099250 missense probably damaging 0.99
R5659:Klhl20 UTSW 1 161090470 missense probably damaging 1.00
R6159:Klhl20 UTSW 1 161105467 missense probably damaging 1.00
R6836:Klhl20 UTSW 1 161105406 missense probably benign 0.18
R6914:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6915:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 161109257 missense probably benign 0.01
R8085:Klhl20 UTSW 1 161093784 missense probably damaging 1.00
R8204:Klhl20 UTSW 1 161106844 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCCCCAGCAGGATATGACG -3'
(R):5'- CCTAGAGACTGTGAATTCCCC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- TGTGAATTCCCCGCGGC -3'
Posted On2016-07-22