Incidental Mutation 'R5216:Wnt2b'
ID 403465
Institutional Source Beutler Lab
Gene Symbol Wnt2b
Ensembl Gene ENSMUSG00000027840
Gene Name wingless-type MMTV integration site family, member 2B
Synonyms Wnt13
MMRRC Submission 042789-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5216 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 104945272-104961921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104961345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 43 (L43P)
Ref Sequence ENSEMBL: ENSMUSP00000029429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029429]
AlphaFold O70283
Predicted Effect possibly damaging
Transcript: ENSMUST00000029429
AA Change: L43P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029429
Gene: ENSMUSG00000027840
AA Change: L43P

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
WNT1 72 378 2.03e-189 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200502
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no discernable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Wnt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wnt2b APN 3 104953133 missense possibly damaging 0.87
IGL02058:Wnt2b APN 3 104947092 missense probably benign 0.04
IGL02638:Wnt2b APN 3 104954716 missense probably benign 0.25
R0881:Wnt2b UTSW 3 104953197 splice site probably benign
R1971:Wnt2b UTSW 3 104954617 splice site probably benign
R2004:Wnt2b UTSW 3 104953015 missense probably damaging 1.00
R4431:Wnt2b UTSW 3 104952940 missense probably damaging 1.00
R6046:Wnt2b UTSW 3 104951023 missense probably damaging 1.00
R6633:Wnt2b UTSW 3 104951056 missense probably damaging 1.00
R6653:Wnt2b UTSW 3 104953186 missense probably damaging 1.00
R6827:Wnt2b UTSW 3 104947092 missense probably benign 0.04
R7352:Wnt2b UTSW 3 104947177 missense probably benign 0.05
R7634:Wnt2b UTSW 3 104947116 missense probably damaging 1.00
R8099:Wnt2b UTSW 3 104947092 missense possibly damaging 0.48
R8972:Wnt2b UTSW 3 104951159 missense possibly damaging 0.79
X0061:Wnt2b UTSW 3 104961360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCCACTGGAAACTTCTGG -3'
(R):5'- ACTCTGTGGGGCGATCTAGG -3'

Sequencing Primer
(F):5'- CACTGGAAACTTCTGGGACTG -3'
(R):5'- CCTGAGGAAGCCCAGACAGTG -3'
Posted On 2016-07-22