Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:Col24a1'

403467

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

042789-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145315310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 481 (E481K)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029848
AA Change: E481K

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: E481K

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139001

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCATCCGGCTTTGCACAC -3'
(R):5'- TCCTATGTTGTATGGTCCAGATACC -3'

Sequencing Primer
(F):5'- GGCTTTGCACACACAAATCAAG -3'
(R):5'- TGGTCCAGATACCTCTTTGAAATAC -3'

Posted On

2016-07-22