Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:Cngb3'

403468

Institutional Source

Beutler Lab

Gene Symbol

Cngb3

Ensembl Gene

ENSMUSG00000056494

Gene Name

cyclic nucleotide gated channel beta 3

Synonyms

CCNC2, CNG6, Cngbeta2

MMRRC Submission

042789-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19280850-19510623 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19415729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 413 (V413D)

Ref Sequence

ENSEMBL: ENSMUSP00000100064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102999]

AlphaFold

Q9JJZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102999
AA Change: V413D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: V413D

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	210	445	5.7e-21	PFAM
cNMP	516	635	5.99e-23	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Cngb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Cngb3	APN	4	19280956	missense	probably damaging	0.98
IGL01301:Cngb3	APN	4	19425625	missense	probably damaging	1.00
IGL01735:Cngb3	APN	4	19415648	missense	probably damaging	1.00
IGL01756:Cngb3	APN	4	19367850	missense	probably damaging	1.00
IGL01812:Cngb3	APN	4	19461728	missense	possibly damaging	0.86
IGL02123:Cngb3	APN	4	19367801	missense	probably damaging	0.99
IGL02636:Cngb3	APN	4	19396690	missense	probably damaging	1.00
IGL02648:Cngb3	APN	4	19428489	missense	probably benign	0.00
IGL02935:Cngb3	APN	4	19425491	missense	possibly damaging	0.95
IGL03025:Cngb3	APN	4	19283498	splice site	probably benign
IGL03068:Cngb3	APN	4	19375246	missense	possibly damaging	0.92
braced	UTSW	4	19395922	splice site	probably benign
ANU18:Cngb3	UTSW	4	19425625	missense	probably damaging	1.00
R0014:Cngb3	UTSW	4	19396685	missense	probably benign	0.33
R0014:Cngb3	UTSW	4	19396685	missense	probably benign	0.33
R0195:Cngb3	UTSW	4	19280975	missense	probably benign	0.00
R0361:Cngb3	UTSW	4	19366467	missense	probably benign	0.00
R0480:Cngb3	UTSW	4	19309517	splice site	probably benign
R1103:Cngb3	UTSW	4	19309658	critical splice donor site	probably null
R1450:Cngb3	UTSW	4	19395922	splice site	probably benign
R1618:Cngb3	UTSW	4	19364260	missense	probably benign
R1891:Cngb3	UTSW	4	19366446	missense	probably benign	0.00
R2196:Cngb3	UTSW	4	19415690	missense	possibly damaging	0.64
R2850:Cngb3	UTSW	4	19415690	missense	possibly damaging	0.64
R3909:Cngb3	UTSW	4	19461679	missense	probably damaging	1.00
R3941:Cngb3	UTSW	4	19396786	missense	probably benign	0.00
R4348:Cngb3	UTSW	4	19396688	missense	probably damaging	1.00
R4490:Cngb3	UTSW	4	19415684	missense	probably benign	0.41
R4493:Cngb3	UTSW	4	19367778	missense	probably damaging	1.00
R4578:Cngb3	UTSW	4	19425613	missense	probably damaging	1.00
R4719:Cngb3	UTSW	4	19309562	missense	probably benign
R4774:Cngb3	UTSW	4	19415713	missense	possibly damaging	0.85
R4860:Cngb3	UTSW	4	19425569	missense	possibly damaging	0.50
R4860:Cngb3	UTSW	4	19425569	missense	possibly damaging	0.50
R4898:Cngb3	UTSW	4	19395926	missense	probably benign	0.08
R5647:Cngb3	UTSW	4	19364266	missense	possibly damaging	0.51
R5945:Cngb3	UTSW	4	19283579	missense	probably null	0.00
R6586:Cngb3	UTSW	4	19280946	missense	probably damaging	0.99
R6650:Cngb3	UTSW	4	19364168	missense	probably damaging	1.00
R6651:Cngb3	UTSW	4	19375231	missense	probably benign	0.01
R7070:Cngb3	UTSW	4	19425593	missense	possibly damaging	0.78
R7316:Cngb3	UTSW	4	19425599	missense	probably benign	0.16
R7371:Cngb3	UTSW	4	19425575	missense	possibly damaging	0.69
R7554:Cngb3	UTSW	4	19461753	nonsense	probably null
R7755:Cngb3	UTSW	4	19461684	missense	probably benign	0.01
R8004:Cngb3	UTSW	4	19505273	missense	possibly damaging	0.85
R8025:Cngb3	UTSW	4	19280960	missense	possibly damaging	0.95
R9143:Cngb3	UTSW	4	19375190	splice site	probably benign
R9366:Cngb3	UTSW	4	19395983	missense	probably benign	0.03
R9489:Cngb3	UTSW	4	19505187	missense	probably benign	0.17
R9605:Cngb3	UTSW	4	19505187	missense	probably benign	0.17
X0062:Cngb3	UTSW	4	19364189	missense	possibly damaging	0.91
X0067:Cngb3	UTSW	4	19367753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAGTTCCTGCATTCATGAAC -3'
(R):5'- TGCTGTAGTGTTGATCCAAGTAC -3'

Sequencing Primer
(F):5'- CCTGCATTCATGAACTGTGTG -3'
(R):5'- CTGTAGTGTTGATCCAAGTACATTCC -3'

Posted On

2016-07-22