Incidental Mutation 'R5216:Cngb3'
ID403468
Institutional Source Beutler Lab
Gene Symbol Cngb3
Ensembl Gene ENSMUSG00000056494
Gene Namecyclic nucleotide gated channel beta 3
SynonymsCCNC2, CNG6, Cngbeta2
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location19280850-19510623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19415729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 413 (V413D)
Ref Sequence ENSEMBL: ENSMUSP00000100064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102999
AA Change: V413D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: V413D

DomainStartEndE-ValueType
Pfam:Ion_trans 210 445 5.7e-21 PFAM
cNMP 516 635 5.99e-23 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Cngb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Cngb3 APN 4 19280956 missense probably damaging 0.98
IGL01301:Cngb3 APN 4 19425625 missense probably damaging 1.00
IGL01735:Cngb3 APN 4 19415648 missense probably damaging 1.00
IGL01756:Cngb3 APN 4 19367850 missense probably damaging 1.00
IGL01812:Cngb3 APN 4 19461728 missense possibly damaging 0.86
IGL02123:Cngb3 APN 4 19367801 missense probably damaging 0.99
IGL02636:Cngb3 APN 4 19396690 missense probably damaging 1.00
IGL02648:Cngb3 APN 4 19428489 missense probably benign 0.00
IGL02935:Cngb3 APN 4 19425491 missense possibly damaging 0.95
IGL03025:Cngb3 APN 4 19283498 splice site probably benign
IGL03068:Cngb3 APN 4 19375246 missense possibly damaging 0.92
braced UTSW 4 19395922 splice site probably benign
ANU18:Cngb3 UTSW 4 19425625 missense probably damaging 1.00
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0195:Cngb3 UTSW 4 19280975 missense probably benign 0.00
R0361:Cngb3 UTSW 4 19366467 missense probably benign 0.00
R0480:Cngb3 UTSW 4 19309517 splice site probably benign
R1103:Cngb3 UTSW 4 19309658 critical splice donor site probably null
R1450:Cngb3 UTSW 4 19395922 splice site probably benign
R1618:Cngb3 UTSW 4 19364260 missense probably benign
R1891:Cngb3 UTSW 4 19366446 missense probably benign 0.00
R2196:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R2850:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R3909:Cngb3 UTSW 4 19461679 missense probably damaging 1.00
R3941:Cngb3 UTSW 4 19396786 missense probably benign 0.00
R4348:Cngb3 UTSW 4 19396688 missense probably damaging 1.00
R4490:Cngb3 UTSW 4 19415684 missense probably benign 0.41
R4493:Cngb3 UTSW 4 19367778 missense probably damaging 1.00
R4578:Cngb3 UTSW 4 19425613 missense probably damaging 1.00
R4719:Cngb3 UTSW 4 19309562 missense probably benign
R4774:Cngb3 UTSW 4 19415713 missense possibly damaging 0.85
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4898:Cngb3 UTSW 4 19395926 missense probably benign 0.08
R5647:Cngb3 UTSW 4 19364266 missense possibly damaging 0.51
R5945:Cngb3 UTSW 4 19283579 missense probably null 0.00
R6586:Cngb3 UTSW 4 19280946 missense probably damaging 0.99
R6650:Cngb3 UTSW 4 19364168 missense probably damaging 1.00
R6651:Cngb3 UTSW 4 19375231 missense probably benign 0.01
R7070:Cngb3 UTSW 4 19425593 missense possibly damaging 0.78
R7316:Cngb3 UTSW 4 19425599 missense probably benign 0.16
R7371:Cngb3 UTSW 4 19425575 missense possibly damaging 0.69
R7554:Cngb3 UTSW 4 19461753 nonsense probably null
R7755:Cngb3 UTSW 4 19461684 missense probably benign 0.01
R8004:Cngb3 UTSW 4 19505273 missense possibly damaging 0.85
R8025:Cngb3 UTSW 4 19280960 missense possibly damaging 0.95
X0062:Cngb3 UTSW 4 19364189 missense possibly damaging 0.91
X0067:Cngb3 UTSW 4 19367753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTTCCTGCATTCATGAAC -3'
(R):5'- TGCTGTAGTGTTGATCCAAGTAC -3'

Sequencing Primer
(F):5'- CCTGCATTCATGAACTGTGTG -3'
(R):5'- CTGTAGTGTTGATCCAAGTACATTCC -3'
Posted On2016-07-22