Mutagenetix > Incidental Mutations

Incidental Mutation 'R5216:Olfr857'

403484

Institutional Source

Beutler Lab

Gene Symbol

Olfr857

Ensembl Gene

ENSMUSG00000094678

Gene Name

olfactory receptor 857

Synonyms

MOR146-8P, GA_x6K02T2PVTD-13452606-13453535

MMRRC Submission

042789-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19709433-19714930 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19713289 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 154 (V154E)

Ref Sequence

ENSEMBL: ENSMUSP00000148617 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]

Predicted Effect

probably benign
Transcript: ENSMUST00000077023
AA Change: V154E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: V154E

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.5e-49	PFAM
Pfam:7TM_GPCR_Srsx	35	304	1.5e-5	PFAM
Pfam:7tm_1	41	290	9.4e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212013
AA Change: V154E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212753
AA Change: V119E

Predicted Effect

probably benign
Transcript: ENSMUST00000217450
AA Change: V154E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Olfr857

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01510:Olfr857	APN	9	19713279	missense	probably benign	0.00
IGL01919:Olfr857	APN	9	19713342	missense	probably benign	0.00
IGL02157:Olfr857	APN	9	19713289	missense	probably benign	0.07
IGL02550:Olfr857	APN	9	19713047	missense	possibly damaging	0.92
IGL03329:Olfr857	APN	9	19713301	missense	probably benign	0.16
IGL02799:Olfr857	UTSW	9	19713018	missense	probably damaging	0.99
R0356:Olfr857	UTSW	9	19713447	missense	probably damaging	1.00
R0927:Olfr857	UTSW	9	19713649	missense	probably benign	0.39
R1161:Olfr857	UTSW	9	19713180	missense	probably damaging	1.00
R1848:Olfr857	UTSW	9	19713090	missense	probably benign	0.01
R5191:Olfr857	UTSW	9	19713334	missense	probably damaging	0.98
R5259:Olfr857	UTSW	9	19712813	splice site	probably null
R5342:Olfr857	UTSW	9	19713037	missense	probably damaging	1.00
R5506:Olfr857	UTSW	9	19713274	missense	possibly damaging	0.61
R5526:Olfr857	UTSW	9	19713698	nonsense	probably null
R5594:Olfr857	UTSW	9	19713006	missense	probably damaging	0.99
R5928:Olfr857	UTSW	9	19713753	missense	probably benign	0.02
R6569:Olfr857	UTSW	9	19713342	missense	probably benign	0.00
R6858:Olfr857	UTSW	9	19713469	missense	probably damaging	0.98
R7077:Olfr857	UTSW	9	19713132	missense	probably benign
R7378:Olfr857	UTSW	9	19712887	missense	probably damaging	1.00
R7771:Olfr857	UTSW	9	19713471	missense	probably benign
R8038:Olfr857	UTSW	9	19713680	missense	possibly damaging	0.52
R8160:Olfr857	UTSW	9	19712789	intron	probably benign
R8223:Olfr857	UTSW	9	19713409	missense	probably benign
R8400:Olfr857	UTSW	9	19713093	missense	probably benign	0.45
R8780:Olfr857	UTSW	9	19713357	missense	possibly damaging	0.92
R8946:Olfr857	UTSW	9	19713589	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCATGCCCATAACAGATCC -3'
(R):5'- TAGGAGTAAAATATTCCTGAGGCAG -3'

Sequencing Primer
(F):5'- CTTATGCTGAATGCCTAACTCAG -3'
(R):5'- CTGAGGCAGGGAGGAAACC -3'

Posted On

2016-07-22