Incidental Mutation 'R5216:Or7e166'
ID 403484
Institutional Source Beutler Lab
Gene Symbol Or7e166
Ensembl Gene ENSMUSG00000094678
Gene Name olfactory receptor family 7 subfamily E member 166
Synonyms MOR146-8P, Olfr857, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission 042789-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5216 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 19624125-19625054 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19624585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 154 (V154E)
Ref Sequence ENSEMBL: ENSMUSP00000148617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]
AlphaFold A0A1L1SUS1
Predicted Effect probably benign
Transcript: ENSMUST00000077023
AA Change: V154E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: V154E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212013
AA Change: V154E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212753
AA Change: V119E
Predicted Effect probably benign
Transcript: ENSMUST00000217450
AA Change: V154E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,107,947 (GRCm39) V84D probably damaging Het
Abcb1b T C 5: 8,863,705 (GRCm39) V220A probably benign Het
Actg1 A T 11: 120,238,580 (GRCm39) M82K probably damaging Het
Ahi1 T C 10: 20,835,975 (GRCm39) S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 (GRCm39) G397C probably damaging Het
Arhgef3 A G 14: 27,123,799 (GRCm39) T507A probably benign Het
Atg7 A G 6: 114,701,910 (GRCm39) D682G probably damaging Het
Atp13a3 A G 16: 30,159,102 (GRCm39) I783T probably damaging Het
Atp9a T C 2: 168,516,808 (GRCm39) I362V probably benign Het
Birc6 T A 17: 74,920,465 (GRCm39) I168K probably damaging Het
Brca2 T A 5: 150,466,445 (GRCm39) Y2070N probably damaging Het
Cabp7 A G 11: 4,688,873 (GRCm39) I199T probably damaging Het
Cacng5 A G 11: 107,768,315 (GRCm39) F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 (GRCm39) V413D possibly damaging Het
Col24a1 G A 3: 145,021,071 (GRCm39) E481K possibly damaging Het
Cspg4b G A 13: 113,478,947 (GRCm39) C1497Y probably benign Het
Ctr9 T A 7: 110,644,665 (GRCm39) I560N possibly damaging Het
Dip2b C T 15: 100,109,867 (GRCm39) R1451C probably damaging Het
Fat3 T C 9: 16,288,833 (GRCm39) D230G probably damaging Het
Gramd4 G A 15: 86,018,986 (GRCm39) probably null Het
Grb14 C T 2: 64,747,653 (GRCm39) V369I probably benign Het
Hoxd1 A T 2: 74,594,695 (GRCm39) N317Y probably damaging Het
Kcnc4 A G 3: 107,346,757 (GRCm39) S623P probably benign Het
Klhl20 A G 1: 160,921,249 (GRCm39) probably null Het
Lamc1 C A 1: 153,103,442 (GRCm39) V1375L probably damaging Het
Lpin2 C T 17: 71,549,755 (GRCm39) S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,026,736 (GRCm39) probably benign Het
Mgll T A 6: 88,743,311 (GRCm39) C110* probably null Het
Mmp14 A G 14: 54,675,120 (GRCm39) N251D possibly damaging Het
Or1e33 A T 11: 73,738,262 (GRCm39) S230T probably damaging Het
Or52k2 A G 7: 102,254,028 (GRCm39) T156A probably benign Het
Pfkl T G 10: 77,845,504 (GRCm39) D5A probably damaging Het
Pik3c3 A G 18: 30,406,029 (GRCm39) Y9C probably damaging Het
Pkhd1l1 T A 15: 44,359,043 (GRCm39) Y417* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Sulf1 T A 1: 12,867,098 (GRCm39) M94K probably benign Het
Synrg A G 11: 83,873,022 (GRCm39) T157A probably damaging Het
Syt1 T C 10: 108,478,118 (GRCm39) N102S probably benign Het
Tnip2 C T 5: 34,661,149 (GRCm39) R101H probably damaging Het
Trmt2a A G 16: 18,070,048 (GRCm39) D421G probably benign Het
Vmn1r67 A G 7: 10,181,090 (GRCm39) D57G probably benign Het
Wnt2b A G 3: 104,868,661 (GRCm39) L43P possibly damaging Het
Zfp113 C T 5: 138,148,977 (GRCm39) D56N probably damaging Het
Zfp184 C T 13: 22,134,406 (GRCm39) L69F probably damaging Het
Zyx T C 6: 42,333,466 (GRCm39) V464A probably damaging Het
Other mutations in Or7e166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Or7e166 APN 9 19,624,575 (GRCm39) missense probably benign 0.00
IGL01919:Or7e166 APN 9 19,624,638 (GRCm39) missense probably benign 0.00
IGL02157:Or7e166 APN 9 19,624,585 (GRCm39) missense probably benign 0.07
IGL02550:Or7e166 APN 9 19,624,343 (GRCm39) missense possibly damaging 0.92
IGL03329:Or7e166 APN 9 19,624,597 (GRCm39) missense probably benign 0.16
IGL02799:Or7e166 UTSW 9 19,624,314 (GRCm39) missense probably damaging 0.99
R0356:Or7e166 UTSW 9 19,624,743 (GRCm39) missense probably damaging 1.00
R0927:Or7e166 UTSW 9 19,624,945 (GRCm39) missense probably benign 0.39
R1161:Or7e166 UTSW 9 19,624,476 (GRCm39) missense probably damaging 1.00
R1848:Or7e166 UTSW 9 19,624,386 (GRCm39) missense probably benign 0.01
R5191:Or7e166 UTSW 9 19,624,630 (GRCm39) missense probably damaging 0.98
R5259:Or7e166 UTSW 9 19,624,109 (GRCm39) splice site probably null
R5342:Or7e166 UTSW 9 19,624,333 (GRCm39) missense probably damaging 1.00
R5506:Or7e166 UTSW 9 19,624,570 (GRCm39) missense possibly damaging 0.61
R5526:Or7e166 UTSW 9 19,624,994 (GRCm39) nonsense probably null
R5594:Or7e166 UTSW 9 19,624,302 (GRCm39) missense probably damaging 0.99
R5928:Or7e166 UTSW 9 19,625,049 (GRCm39) missense probably benign 0.02
R6569:Or7e166 UTSW 9 19,624,638 (GRCm39) missense probably benign 0.00
R6858:Or7e166 UTSW 9 19,624,765 (GRCm39) missense probably damaging 0.98
R7077:Or7e166 UTSW 9 19,624,428 (GRCm39) missense probably benign
R7378:Or7e166 UTSW 9 19,624,183 (GRCm39) missense probably damaging 1.00
R7771:Or7e166 UTSW 9 19,624,767 (GRCm39) missense probably benign
R8038:Or7e166 UTSW 9 19,624,976 (GRCm39) missense possibly damaging 0.52
R8160:Or7e166 UTSW 9 19,624,085 (GRCm39) intron probably benign
R8223:Or7e166 UTSW 9 19,624,705 (GRCm39) missense probably benign
R8400:Or7e166 UTSW 9 19,624,389 (GRCm39) missense probably benign 0.45
R8780:Or7e166 UTSW 9 19,624,653 (GRCm39) missense possibly damaging 0.92
R8946:Or7e166 UTSW 9 19,624,885 (GRCm39) missense probably damaging 0.99
R9164:Or7e166 UTSW 9 19,624,954 (GRCm39) missense probably benign 0.25
R9475:Or7e166 UTSW 9 19,624,939 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATGCCCATAACAGATCC -3'
(R):5'- TAGGAGTAAAATATTCCTGAGGCAG -3'

Sequencing Primer
(F):5'- CTTATGCTGAATGCCTAACTCAG -3'
(R):5'- CTGAGGCAGGGAGGAAACC -3'
Posted On 2016-07-22