Incidental Mutation 'R5216:Pfkl'
ID403486
Institutional Source Beutler Lab
Gene Symbol Pfkl
Ensembl Gene ENSMUSG00000020277
Gene Namephosphofructokinase, liver, B-type
Synonyms
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5216 (G1)
Quality Score197
Status Not validated
Chromosome10
Chromosomal Location77986947-78010083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78009670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 5 (D5A)
Ref Sequence ENSEMBL: ENSMUSP00000151375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]
Predicted Effect probably benign
Transcript: ENSMUST00000020522
AA Change: D5A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277
AA Change: D5A

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145716
Predicted Effect probably damaging
Transcript: ENSMUST00000218383
AA Change: D5A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220304
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Pfkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Pfkl APN 10 77991395 missense probably benign
IGL01759:Pfkl APN 10 78000731 missense probably damaging 1.00
IGL02697:Pfkl APN 10 77999918 missense probably benign 0.09
IGL02870:Pfkl APN 10 78000839 nonsense probably null
IGL02942:Pfkl APN 10 78000133 critical splice donor site probably null
IGL02972:Pfkl APN 10 77988274 missense probably benign 0.00
IGL03342:Pfkl APN 10 78005475 missense possibly damaging 0.95
ANU23:Pfkl UTSW 10 77991395 missense probably benign
R0226:Pfkl UTSW 10 77992534 missense probably benign 0.00
R0743:Pfkl UTSW 10 77995243 critical splice donor site probably null
R0899:Pfkl UTSW 10 78005439 critical splice donor site probably null
R0926:Pfkl UTSW 10 78000689 missense probably damaging 1.00
R1264:Pfkl UTSW 10 77993416 missense possibly damaging 0.46
R1782:Pfkl UTSW 10 77988720 missense probably benign 0.00
R1918:Pfkl UTSW 10 78001426 missense probably damaging 1.00
R3743:Pfkl UTSW 10 77996345 missense probably damaging 1.00
R4559:Pfkl UTSW 10 77988883 missense probably benign 0.00
R4804:Pfkl UTSW 10 77991394 missense probably benign
R4823:Pfkl UTSW 10 77997594 missense probably damaging 1.00
R4906:Pfkl UTSW 10 77988310 missense probably damaging 1.00
R5082:Pfkl UTSW 10 77996408 missense probably damaging 1.00
R5380:Pfkl UTSW 10 77997589 missense possibly damaging 0.86
R5816:Pfkl UTSW 10 78002022 missense possibly damaging 0.75
R5840:Pfkl UTSW 10 77988724 missense probably benign
R5888:Pfkl UTSW 10 77991370 missense possibly damaging 0.68
R6143:Pfkl UTSW 10 77989613 missense probably damaging 0.96
R6152:Pfkl UTSW 10 77990151 missense probably benign 0.00
R6251:Pfkl UTSW 10 77989565 critical splice donor site probably null
R6262:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6382:Pfkl UTSW 10 77999837 missense probably damaging 0.98
R6407:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6547:Pfkl UTSW 10 77995354 missense probably benign
R6704:Pfkl UTSW 10 77996366 missense probably damaging 1.00
R6996:Pfkl UTSW 10 77997589 missense probably damaging 1.00
R7116:Pfkl UTSW 10 78001415 missense probably benign
R7154:Pfkl UTSW 10 78001455 missense probably benign 0.41
R7183:Pfkl UTSW 10 78002082 nonsense probably null
R7248:Pfkl UTSW 10 77989589 missense probably damaging 1.00
R7252:Pfkl UTSW 10 77993429 missense probably damaging 1.00
R7278:Pfkl UTSW 10 77992023 missense probably damaging 0.99
X0026:Pfkl UTSW 10 77989643 missense probably damaging 1.00
Z1176:Pfkl UTSW 10 78000136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAAAGGAATAGCCCGGTGC -3'
(R):5'- TTCTCCAGCAGCCACTAGAG -3'

Sequencing Primer
(F):5'- AATAGCCCGGTGCCCTAAGTC -3'
(R):5'- AGCCACTAGAGGGGCGAC -3'
Posted On2016-07-22