Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:Rptor'

403491

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

raptor, Rap, 4932417H02Rik

MMRRC Submission

042789-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119602905-119899576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119843713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 514 (G514D)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000124401] [ENSMUST00000139728] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026671
AA Change: G514D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: G514D

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124401
AA Change: G36D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125503
Gene: ENSMUSG00000025583
AA Change: G36D

Domain	Start	End	E-Value	Type
Pfam:HEAT	58	88	1.2e-5	PFAM
Pfam:HEAT_2	101	170	3.9e-8	PFAM
Pfam:HEAT	102	130	1.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127899

Predicted Effect

probably benign
Transcript: ENSMUST00000139728

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147772

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.7267

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119799445	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119891170	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119896436	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119857453	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119657674	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119846915	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119780587	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119892612	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119725145	missense	probably damaging	1.00
Velocipede	UTSW	11	119895977	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119884967	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119872367	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119894912	splice site	probably benign
R0219:Rptor	UTSW	11	119821777	intron	probably benign
R0324:Rptor	UTSW	11	119892641	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119780553	nonsense	probably null
R0718:Rptor	UTSW	11	119872376	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119884954	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119843743	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119743891	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119780593	nonsense	probably null
R1579:Rptor	UTSW	11	119896001	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119725061	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119756320	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119725144	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119756322	nonsense	probably null
R2275:Rptor	UTSW	11	119756322	nonsense	probably null
R2408:Rptor	UTSW	11	119857451	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119865594	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119856298	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119671345	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119798840	missense	probably null	1.00
R4647:Rptor	UTSW	11	119891163	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119743882	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119857391	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119821640	intron	probably benign
R5073:Rptor	UTSW	11	119896479	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119603816	missense	probably benign
R5219:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119822956	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119756249	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119897442	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119896012	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119895977	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119756345	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119846936	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119874186	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119872355	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119884979	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119743953	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119892627	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119857953	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119857937	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119811986	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119892647	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119892639	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119725032	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119603925	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119843682	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119887070	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119603939	missense	probably benign
R9224:Rptor	UTSW	11	119894287	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119811997	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119895946	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119671326	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119891114	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119887138	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119846405	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119857866	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119603972	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119756236	splice site	probably null
Z0001:Rptor	UTSW	11	119756415	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119799319	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119846752	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119851468	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119857453	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119871492	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119874151	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119896549	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGCCTTTTCCCAAGTGAAATC -3'
(R):5'- GGAAGACCAGATTCTCACCC -3'

Sequencing Primer
(F):5'- CAAGTGAAATCTGGCCTTGC -3'
(R):5'- ATTCTCACCCAGGGCAGGAAG -3'

Posted On

2016-07-22