Incidental Mutation 'R5216:Actg1'
ID403492
Institutional Source Beutler Lab
Gene Symbol Actg1
Ensembl Gene ENSMUSG00000062825
Gene Nameactin, gamma, cytoplasmic 1
SynonymsActl, E51
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120345690-120348542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120347754 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 82 (M82K)
Ref Sequence ENSEMBL: ENSMUSP00000101822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062147] [ENSMUST00000071555] [ENSMUST00000089616] [ENSMUST00000106215] [ENSMUST00000128055] [ENSMUST00000131103]
Predicted Effect probably benign
Transcript: ENSMUST00000062147
SMART Domains Protein: ENSMUSP00000101821
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 5 153 1.43e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071555
AA Change: M82K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071486
Gene: ENSMUSG00000062825
AA Change: M82K

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089616
SMART Domains Protein: ENSMUSP00000087043
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 1 84 3.8e-32 PFAM
Pfam:Actin 78 105 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106215
AA Change: M82K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101822
Gene: ENSMUSG00000062825
AA Change: M82K

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128055
AA Change: M139K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134296
Gene: ENSMUSG00000062825
AA Change: M139K

DomainStartEndE-ValueType
ACTIN 62 268 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131103
AA Change: M82K

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134070
Gene: ENSMUSG00000062825
AA Change: M82K

DomainStartEndE-ValueType
Pfam:Actin 2 124 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183615
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice in which this gene has been conditionally disrupted in muscle tissue display a reduced mobility and classical hind limb contractures when suspended by the tail. Mice homozygous for a null allele exhibit prenatal lethality, premature death, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Actg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Actg1 UTSW 11 120346949 missense probably damaging 1.00
R2015:Actg1 UTSW 11 120346810 missense possibly damaging 0.95
R2860:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2861:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2862:Actg1 UTSW 11 120346801 missense probably benign 0.03
R4473:Actg1 UTSW 11 120348259 missense probably benign 0.01
R4732:Actg1 UTSW 11 120347479 splice site probably benign
R5004:Actg1 UTSW 11 120348160 intron probably benign
R5026:Actg1 UTSW 11 120346958 missense probably damaging 1.00
R5060:Actg1 UTSW 11 120347013 missense probably benign 0.10
R6328:Actg1 UTSW 11 120347760 missense possibly damaging 0.90
R6660:Actg1 UTSW 11 120346755 missense probably damaging 1.00
R6888:Actg1 UTSW 11 120347315 missense probably damaging 1.00
Z1177:Actg1 UTSW 11 120348109 missense not run
Predicted Primers PCR Primer
(F):5'- AATGACTCGTCACGCCCAAG -3'
(R):5'- TCATTGACAATGGCTCCGGC -3'

Sequencing Primer
(F):5'- CCAAGGGGAGGCAAGGTCC -3'
(R):5'- CCGACACCAGGTTAGTTGAG -3'
Posted On2016-07-22