Incidental Mutation 'R5216:2700097O09Rik'
ID403493
Institutional Source Beutler Lab
Gene Symbol 2700097O09Rik
Ensembl Gene ENSMUSG00000062198
Gene NameRIKEN cDNA 2700097O09 gene
Synonyms
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55045661-55080110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55061162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 84 (V84D)
Ref Sequence ENSEMBL: ENSMUSP00000021406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021406]
Predicted Effect probably damaging
Transcript: ENSMUST00000021406
AA Change: V84D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021406
Gene: ENSMUSG00000062198
AA Change: V84D

DomainStartEndE-ValueType
Pfam:Methyltransf_18 143 253 3.1e-8 PFAM
Pfam:CheR 172 269 7.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222572
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in 2700097O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:2700097O09Rik APN 12 55048963 missense probably damaging 1.00
IGL02618:2700097O09Rik APN 12 55057301 nonsense probably null
IGL03340:2700097O09Rik APN 12 55080001 missense probably benign 0.10
R0844:2700097O09Rik UTSW 12 55080073 missense possibly damaging 0.62
R1489:2700097O09Rik UTSW 12 55059510 missense possibly damaging 0.94
R4722:2700097O09Rik UTSW 12 55061137 missense probably benign 0.24
R4786:2700097O09Rik UTSW 12 55059536 missense possibly damaging 0.88
R4981:2700097O09Rik UTSW 12 55048987 splice site probably null
R6787:2700097O09Rik UTSW 12 55079983 missense probably benign 0.06
R7014:2700097O09Rik UTSW 12 55045942 missense probably benign
R7895:2700097O09Rik UTSW 12 55059510 missense probably benign 0.03
R7978:2700097O09Rik UTSW 12 55059510 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACTTATCTATTTACTCAGCGTGTG -3'
(R):5'- GCCATGTTTTGTGATCTTCCAG -3'

Sequencing Primer
(F):5'- CCTCAATGTGCATGTGACAG -3'
(R):5'- TTGTGATCTTCCAGATTAAAGACAG -3'
Posted On2016-07-22