Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:BC067074'

403494

Institutional Source

Beutler Lab

Gene Symbol

BC067074

Ensembl Gene

ENSMUSG00000021763

Gene Name

cDNA sequence BC067074

Synonyms

MMRRC Submission

042789-MU

Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R5216 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113293159-113379711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 113342413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 1497 (C1497Y)

Ref Sequence

ENSEMBL: ENSMUSP00000119993 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]

AlphaFold

F6RXI4

Predicted Effect

probably benign
Transcript: ENSMUST00000078163

SMART Domains

Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763

Domain	Start	End	E-Value	Type
Pfam:Cadherin_3	29	136	4.6e-12	PFAM
low complexity region	190	198	N/A	INTRINSIC
Pfam:Cadherin_3	231	384	4.9e-38	PFAM
transmembrane domain	725	747	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136755
AA Change: C1497Y

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: C1497Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LamG	44	177	1.28e-20	SMART
LamG	229	371	4.66e-14	SMART
low complexity region	407	420	N/A	INTRINSIC
Pfam:Cadherin_3	492	644	2.1e-35	PFAM
Pfam:Cadherin_3	647	759	1e-7	PFAM
Pfam:Cadherin_3	741	873	1.2e-8	PFAM
Pfam:Cadherin_3	861	989	4.1e-14	PFAM
Pfam:Cadherin_3	958	1114	1.2e-20	PFAM
Pfam:Cadherin_3	1117	1223	1.6e-10	PFAM
Pfam:Cadherin_3	1212	1341	5.6e-12	PFAM
Pfam:Cadherin_3	1347	1438	3.8e-8	PFAM
Pfam:Cadherin_3	1419	1562	2.3e-45	PFAM
Pfam:Cadherin_3	1576	1679	2.1e-9	PFAM
low complexity region	1732	1740	N/A	INTRINSIC
Pfam:Cadherin_3	1773	1926	3e-35	PFAM
transmembrane domain	2267	2289	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pik3c3	A	G	18: 30,272,976	Y9C	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in BC067074

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:BC067074	APN	13	113367557	missense	possibly damaging	0.91
IGL03023:BC067074	APN	13	113351741	missense	probably benign	0.03
cumpleanos	UTSW	13	113368336	missense	possibly damaging	0.87
Sorpresa	UTSW	13	113318191	missense	probably damaging	1.00
P0018:BC067074	UTSW	13	113367506	missense	possibly damaging	0.60
R0003:BC067074	UTSW	13	113368776	missense	probably benign	0.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0158:BC067074	UTSW	13	113369153	nonsense	probably null
R0281:BC067074	UTSW	13	113369143	missense	probably damaging	1.00
R1212:BC067074	UTSW	13	113369417	intron	probably benign
R1300:BC067074	UTSW	13	113366160	missense	probably damaging	1.00
R1434:BC067074	UTSW	13	113368492	missense	possibly damaging	0.46
R1509:BC067074	UTSW	13	113368256	missense	probably damaging	0.99
R1738:BC067074	UTSW	13	113367500	missense	possibly damaging	0.69
R1758:BC067074	UTSW	13	113368732	missense	possibly damaging	0.78
R1828:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R2061:BC067074	UTSW	13	113318094	missense	probably damaging	0.99
R2570:BC067074	UTSW	13	113318587	missense	probably benign	0.34
R2884:BC067074	UTSW	13	113320682	missense	probably damaging	1.00
R2884:BC067074	UTSW	13	113369191	missense	probably benign	0.00
R3004:BC067074	UTSW	13	113366154	missense	probably damaging	1.00
R3150:BC067074	UTSW	13	113351760	missense	probably damaging	1.00
R3773:BC067074	UTSW	13	113318209	missense	probably benign	0.12
R3864:BC067074	UTSW	13	113322951	missense	possibly damaging	0.64
R3971:BC067074	UTSW	13	113317126	missense	probably damaging	1.00
R4004:BC067074	UTSW	13	113318380	missense	probably benign	0.00
R4271:BC067074	UTSW	13	113342370	missense	possibly damaging	0.76
R4382:BC067074	UTSW	13	113322754	missense	probably benign	0.10
R4484:BC067074	UTSW	13	113319199	missense	probably damaging	0.98
R4570:BC067074	UTSW	13	113318191	missense	probably damaging	1.00
R4600:BC067074	UTSW	13	113319249	missense	possibly damaging	0.95
R4622:BC067074	UTSW	13	113320081	missense	probably benign	0.00
R4676:BC067074	UTSW	13	113368807	missense	probably damaging	0.98
R4676:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R4677:BC067074	UTSW	13	113379486	missense	unknown
R4775:BC067074	UTSW	13	113317695	missense	possibly damaging	0.91
R4779:BC067074	UTSW	13	113368336	missense	possibly damaging	0.87
R4780:BC067074	UTSW	13	113317858	missense	probably damaging	1.00
R4829:BC067074	UTSW	13	113368162	missense	probably benign	0.05
R4841:BC067074	UTSW	13	113366190	missense	probably benign	0.00
R4879:BC067074	UTSW	13	113319787	missense	probably benign	0.03
R4930:BC067074	UTSW	13	113327662	missense	probably damaging	1.00
R4934:BC067074	UTSW	13	113368348	missense	probably damaging	1.00
R4987:BC067074	UTSW	13	113318101	missense	probably benign	0.07
R5065:BC067074	UTSW	13	113320919	missense	probably benign	0.01
R5236:BC067074	UTSW	13	113366220	missense	probably benign	0.14
R5247:BC067074	UTSW	13	113319459	missense	probably damaging	1.00
R5250:BC067074	UTSW	13	113319771	missense	possibly damaging	0.95
R5337:BC067074	UTSW	13	113318765	missense	probably damaging	1.00
R5342:BC067074	UTSW	13	113366269	critical splice donor site	probably null
R5426:BC067074	UTSW	13	113369053	missense	probably benign	0.01
R5472:BC067074	UTSW	13	113319169	missense	probably benign	0.12
R5526:BC067074	UTSW	13	113367893	missense	probably benign	0.22
R5543:BC067074	UTSW	13	113320873	missense	probably damaging	0.96
R5589:BC067074	UTSW	13	113317950	missense	possibly damaging	0.95
R5623:BC067074	UTSW	13	113346634	missense	possibly damaging	0.95
R5668:BC067074	UTSW	13	113317167	missense	possibly damaging	0.55
R5793:BC067074	UTSW	13	113321022	missense	possibly damaging	0.75
R5824:BC067074	UTSW	13	113368620	missense	probably damaging	1.00
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6053:BC067074	UTSW	13	113320726	missense	possibly damaging	0.51
R6125:BC067074	UTSW	13	113317683	missense	probably benign	0.00
R6129:BC067074	UTSW	13	113368806	nonsense	probably null
R6290:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6291:BC067074	UTSW	13	113320447	missense	possibly damaging	0.85
R6302:BC067074	UTSW	13	113368112	missense	probably damaging	1.00
R6317:BC067074	UTSW	13	113368268	missense	probably benign	0.09
R6395:BC067074	UTSW	13	113369469	missense	probably damaging	1.00
R6673:BC067074	UTSW	13	113367832	nonsense	probably null
R6783:BC067074	UTSW	13	113320209	nonsense	probably null
R6800:BC067074	UTSW	13	113368152	missense	probably benign	0.02
R6857:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6889:BC067074	UTSW	13	113318378	missense	probably damaging	0.99
R6934:BC067074	UTSW	13	113369266	missense	probably benign
R7019:BC067074	UTSW	13	113351750	missense	probably benign	0.01
R7100:BC067074	UTSW	13	113318967	missense
R7115:BC067074	UTSW	13	113320776	missense
R7152:BC067074	UTSW	13	113318850	missense
R7195:BC067074	UTSW	13	113367929	missense
R7213:BC067074	UTSW	13	113317941	missense
R7250:BC067074	UTSW	13	113318815	missense
R7341:BC067074	UTSW	13	113318172	missense
R7358:BC067074	UTSW	13	113319967	missense
R7359:BC067074	UTSW	13	113342430	missense
R7396:BC067074	UTSW	13	113318990	missense
R7632:BC067074	UTSW	13	113320886	missense
R7689:BC067074	UTSW	13	113379414	missense
R7713:BC067074	UTSW	13	113346541	missense
R7892:BC067074	UTSW	13	113319606	missense
R7975:BC067074	UTSW	13	113319307	missense
R8017:BC067074	UTSW	13	113319623	missense
R8019:BC067074	UTSW	13	113319623	missense
R8034:BC067074	UTSW	13	113342511	missense
R8101:BC067074	UTSW	13	113320891	missense
R8104:BC067074	UTSW	13	113319729	missense
R8122:BC067074	UTSW	13	113318908	missense
R8126:BC067074	UTSW	13	113368163	missense
R8272:BC067074	UTSW	13	113368355	missense
R8679:BC067074	UTSW	13	113351629	missense
R8973:BC067074	UTSW	13	113319759	missense
R9123:BC067074	UTSW	13	113368840	missense
R9125:BC067074	UTSW	13	113368840	missense
R9182:BC067074	UTSW	13	113320824	missense
R9233:BC067074	UTSW	13	113366220	missense
R9264:BC067074	UTSW	13	113319480	missense
R9306:BC067074	UTSW	13	113369476	missense	unknown
R9327:BC067074	UTSW	13	113317176	missense
R9411:BC067074	UTSW	13	113368233	missense
R9516:BC067074	UTSW	13	113319115	missense
R9562:BC067074	UTSW	13	113368040	missense
R9605:BC067074	UTSW	13	113319969	missense

Predicted Primers

PCR Primer
(F):5'- CTGCATTGTTTGGCATTCCATG -3'
(R):5'- GACACCGCTTTGTTCTGTGAC -3'

Sequencing Primer
(F):5'- ACACTGGCATGTACATGGTGC -3'
(R):5'- GTGACTTACCAGTGTGCACGAAC -3'

Posted On

2016-07-22