Incidental Mutation 'R5216:Mmp14'
ID403496
Institutional Source Beutler Lab
Gene Symbol Mmp14
Ensembl Gene ENSMUSG00000000957
Gene Namematrix metallopeptidase 14 (membrane-inserted)
Synonymssabe, Membrane type 1-MMP, MT1-MMP
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R5216 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54431612-54445364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54437663 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 251 (N251D)
Ref Sequence ENSEMBL: ENSMUSP00000153679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089688] [ENSMUST00000196155] [ENSMUST00000197874] [ENSMUST00000225641]
Predicted Effect probably benign
Transcript: ENSMUST00000089688
AA Change: N251D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087119
Gene: ENSMUSG00000000957
AA Change: N251D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:PG_binding_1 36 88 2.1e-12 PFAM
ZnMc 115 285 6.01e-58 SMART
HX 323 366 3.97e-9 SMART
HX 368 412 1.42e-10 SMART
HX 415 461 4.45e-12 SMART
HX 463 508 1.61e-9 SMART
Pfam:DUF3377 512 582 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196155
Predicted Effect probably benign
Transcript: ENSMUST00000197874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198679
Predicted Effect possibly damaging
Transcript: ENSMUST00000225641
AA Change: N251D

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226710
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues. [provided by RefSeq, Feb 2016]
PHENOTYPE: Nullizygous mutations may lead to postnatal or premature death, craniofacial anomalies, skeletal dysplasia, low body weight, reduced bone formation and chondrocyte proliferation, arthritis, and fibrosis as well as defects in angiogenesis and lung, tooth,kidney, and submaxillary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pik3c3 A G 18: 30,272,976 Y9C probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Mmp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Mmp14 APN 14 54435790 missense possibly damaging 0.60
IGL01937:Mmp14 APN 14 54437596 splice site probably benign
IGL02565:Mmp14 APN 14 54440557 missense probably benign 0.02
cartoon UTSW 14 54439999 missense probably damaging 0.96
mumping UTSW 14 54439412 missense probably damaging 1.00
IGL03134:Mmp14 UTSW 14 54439106 missense probably damaging 1.00
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0053:Mmp14 UTSW 14 54438652 splice site probably benign
R0538:Mmp14 UTSW 14 54438709 missense possibly damaging 0.47
R0612:Mmp14 UTSW 14 54440434 missense probably damaging 1.00
R2352:Mmp14 UTSW 14 54440545 missense probably benign 0.30
R3700:Mmp14 UTSW 14 54431932 unclassified probably benign
R4289:Mmp14 UTSW 14 54436208 nonsense probably null
R4888:Mmp14 UTSW 14 54436205 missense probably damaging 0.98
R5068:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5069:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5070:Mmp14 UTSW 14 54439113 missense probably damaging 1.00
R5607:Mmp14 UTSW 14 54439412 missense probably damaging 1.00
R6053:Mmp14 UTSW 14 54435890 missense probably benign 0.39
R6477:Mmp14 UTSW 14 54437658 missense probably damaging 1.00
R7153:Mmp14 UTSW 14 54436251 missense possibly damaging 0.93
R7212:Mmp14 UTSW 14 54435879 missense probably damaging 1.00
R7555:Mmp14 UTSW 14 54437742 missense possibly damaging 0.96
R7957:Mmp14 UTSW 14 54436250 missense probably benign 0.01
R8263:Mmp14 UTSW 14 54435787 missense probably damaging 1.00
R8409:Mmp14 UTSW 14 54440668 missense probably damaging 1.00
R8785:Mmp14 UTSW 14 54436775 missense probably damaging 1.00
RF003:Mmp14 UTSW 14 54439014 nonsense probably null
X0064:Mmp14 UTSW 14 54431946 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTCCTGAACCAAATAGGAAGCTG -3'
(R):5'- AGACTTCACACATGATGGAGGG -3'

Sequencing Primer
(F):5'- GGAAGCTGACCCTCAGGACTTTATC -3'
(R):5'- CTTCACACATGATGGAGGGAAAATGC -3'
Posted On2016-07-22