Incidental Mutation 'R5216:Pik3c3'
ID403504
Institutional Source Beutler Lab
Gene Symbol Pik3c3
Ensembl Gene ENSMUSG00000033628
Gene Namephosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms5330434F23Rik, Vps34
MMRRC Submission 042789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5216 (G1)
Quality Score170
Status Not validated
Chromosome18
Chromosomal Location30272747-30348126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30272976 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 9 (Y9C)
Ref Sequence ENSEMBL: ENSMUSP00000111479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115811] [ENSMUST00000115812] [ENSMUST00000131405]
Predicted Effect probably damaging
Transcript: ENSMUST00000091978
AA Change: Y9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: Y9C

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 848 1.02e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115811
AA Change: Y9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111478
Gene: ENSMUSG00000033628
AA Change: Y9C

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 756 5.33e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115812
AA Change: Y9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628
AA Change: Y9C

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 884 1.21e-118 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131405
AA Change: Y9C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628
AA Change: Y9C

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 506 1.78e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,061,162 V84D probably damaging Het
Abcb1b T C 5: 8,813,705 V220A probably benign Het
Actg1 A T 11: 120,347,754 M82K probably damaging Het
Ahi1 T C 10: 20,960,076 S103P probably benign Het
Aldh1b1 G T 4: 45,803,652 G397C probably damaging Het
Arhgef3 A G 14: 27,401,842 T507A probably benign Het
Atg7 A G 6: 114,724,949 D682G probably damaging Het
Atp13a3 A G 16: 30,340,284 I783T probably damaging Het
Atp9a T C 2: 168,674,888 I362V probably benign Het
BC067074 G A 13: 113,342,413 C1497Y probably benign Het
Birc6 T A 17: 74,613,470 I168K probably damaging Het
Brca2 T A 5: 150,542,980 Y2070N probably damaging Het
Cabp7 A G 11: 4,738,873 I199T probably damaging Het
Cacng5 A G 11: 107,877,489 F231L possibly damaging Het
Cngb3 T A 4: 19,415,729 V413D possibly damaging Het
Col24a1 G A 3: 145,315,310 E481K possibly damaging Het
Ctr9 T A 7: 111,045,458 I560N possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Fat3 T C 9: 16,377,537 D230G probably damaging Het
Gramd4 G A 15: 86,134,785 probably null Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Hoxd1 A T 2: 74,764,351 N317Y probably damaging Het
Kcnc4 A G 3: 107,439,441 S623P probably benign Het
Klhl20 A G 1: 161,093,679 probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lpin2 C T 17: 71,242,760 S640L probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Mgll T A 6: 88,766,329 C110* probably null Het
Mmp14 A G 14: 54,437,663 N251D possibly damaging Het
Olfr393 A T 11: 73,847,436 S230T probably damaging Het
Olfr552 A G 7: 102,604,821 T156A probably benign Het
Olfr857 T A 9: 19,713,289 V154E probably benign Het
Pfkl T G 10: 78,009,670 D5A probably damaging Het
Pkhd1l1 T A 15: 44,495,647 Y417* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Sulf1 T A 1: 12,796,874 M94K probably benign Het
Synrg A G 11: 83,982,196 T157A probably damaging Het
Syt1 T C 10: 108,642,257 N102S probably benign Het
Tnip2 C T 5: 34,503,805 R101H probably damaging Het
Trmt2a A G 16: 18,252,184 D421G probably benign Het
Vmn1r67 A G 7: 10,447,163 D57G probably benign Het
Wnt2b A G 3: 104,961,345 L43P possibly damaging Het
Zfp113 C T 5: 138,150,715 D56N probably damaging Het
Zfp184 C T 13: 21,950,236 L69F probably damaging Het
Zyx T C 6: 42,356,532 V464A probably damaging Het
Other mutations in Pik3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pik3c3 APN 18 30303078 splice site probably benign
IGL00743:Pik3c3 APN 18 30274364 missense probably damaging 1.00
IGL01622:Pik3c3 APN 18 30290525 nonsense probably null
IGL01622:Pik3c3 APN 18 30293049 splice site probably benign
IGL01623:Pik3c3 APN 18 30290525 nonsense probably null
IGL01623:Pik3c3 APN 18 30293049 splice site probably benign
IGL01773:Pik3c3 APN 18 30277102 missense probably damaging 1.00
IGL01917:Pik3c3 APN 18 30274446 missense probably damaging 1.00
IGL02033:Pik3c3 APN 18 30312650 missense possibly damaging 0.85
IGL02465:Pik3c3 APN 18 30344060 missense probably damaging 0.97
IGL03161:Pik3c3 APN 18 30293707 missense probably benign 0.37
IGL03221:Pik3c3 APN 18 30302931 missense probably benign 0.45
H8786:Pik3c3 UTSW 18 30294343 missense probably damaging 0.99
R0089:Pik3c3 UTSW 18 30303078 splice site probably benign
R1512:Pik3c3 UTSW 18 30322236 critical splice donor site probably null
R1713:Pik3c3 UTSW 18 30323586 missense possibly damaging 0.73
R1758:Pik3c3 UTSW 18 30277010 missense probably damaging 1.00
R1822:Pik3c3 UTSW 18 30344077 critical splice donor site probably null
R1870:Pik3c3 UTSW 18 30293132 critical splice donor site probably null
R2680:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R3768:Pik3c3 UTSW 18 30333273 missense probably damaging 1.00
R3926:Pik3c3 UTSW 18 30311329 splice site probably benign
R4154:Pik3c3 UTSW 18 30311283 missense probably benign 0.35
R4293:Pik3c3 UTSW 18 30343990 missense probably damaging 1.00
R4570:Pik3c3 UTSW 18 30290550 missense possibly damaging 0.94
R4858:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R4893:Pik3c3 UTSW 18 30282000 missense probably benign 0.16
R4901:Pik3c3 UTSW 18 30302929 missense possibly damaging 0.65
R5358:Pik3c3 UTSW 18 30323544 missense probably damaging 1.00
R5373:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5374:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5600:Pik3c3 UTSW 18 30311293 missense probably damaging 1.00
R5680:Pik3c3 UTSW 18 30277113 nonsense probably null
R5965:Pik3c3 UTSW 18 30298580 missense probably damaging 1.00
R6492:Pik3c3 UTSW 18 30324562 missense probably damaging 1.00
R6576:Pik3c3 UTSW 18 30342741 intron probably benign
R6700:Pik3c3 UTSW 18 30316901 missense probably benign 0.02
R7523:Pik3c3 UTSW 18 30293655 missense probably damaging 1.00
R7883:Pik3c3 UTSW 18 30274363 missense probably benign 0.04
R7884:Pik3c3 UTSW 18 30312571 missense probably benign 0.00
R7886:Pik3c3 UTSW 18 30319588 nonsense probably null
R8075:Pik3c3 UTSW 18 30305029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTGCACATGCGTACAGC -3'
(R):5'- GCGGTATTCCCACAAAAGCG -3'

Sequencing Primer
(F):5'- CAGGGGCTGTTCCGTCG -3'
(R):5'- GGAACACGCAAAGGGCTCC -3'
Posted On2016-07-22