Mutagenetix > Incidental Mutation

Incidental Mutation 'R5216:Pik3c3'

403504

Institutional Source

Beutler Lab

Gene Symbol

Pik3c3

Ensembl Gene

ENSMUSG00000033628

Gene Name

phosphatidylinositol 3-kinase catalytic subunit type 3

Synonyms

5330434F23Rik, Vps34

MMRRC Submission

042789-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5216 (G1)

Quality Score

170

Status

Not validated

Chromosome

Chromosomal Location

30272747-30348126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30272976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 9 (Y9C)

Ref Sequence

ENSEMBL: ENSMUSP00000111479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115811] [ENSMUST00000115812] [ENSMUST00000131405]

AlphaFold

Q6PF93

Predicted Effect

probably damaging
Transcript: ENSMUST00000091978
AA Change: Y9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: Y9C

Domain	Start	End	E-Value	Type
C2	20	141	4.44e0	SMART
PI3K_C2	21	130	1.43e-42	SMART
PI3Ka	283	530	3.08e-111	SMART
PI3Kc	632	848	1.02e-84	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115811
AA Change: Y9C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111478
Gene: ENSMUSG00000033628
AA Change: Y9C

Domain	Start	End	E-Value	Type
C2	20	141	4.44e0	SMART
PI3K_C2	21	130	1.43e-42	SMART
PI3Ka	283	530	3.08e-111	SMART
PI3Kc	632	756	5.33e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115812
AA Change: Y9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628
AA Change: Y9C

Domain	Start	End	E-Value	Type
C2	20	141	4.44e0	SMART
PI3K_C2	21	130	1.43e-42	SMART
PI3Ka	283	530	3.08e-111	SMART
PI3Kc	632	884	1.21e-118	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131405
AA Change: Y9C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628
AA Change: Y9C

Domain	Start	End	E-Value	Type
C2	20	141	4.44e0	SMART
PI3K_C2	21	130	1.43e-42	SMART
PI3Ka	283	506	1.78e-84	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700097O09Rik	A	T	12: 55,061,162	V84D	probably damaging	Het
Abcb1b	T	C	5: 8,813,705	V220A	probably benign	Het
Actg1	A	T	11: 120,347,754	M82K	probably damaging	Het
Ahi1	T	C	10: 20,960,076	S103P	probably benign	Het
Aldh1b1	G	T	4: 45,803,652	G397C	probably damaging	Het
Arhgef3	A	G	14: 27,401,842	T507A	probably benign	Het
Atg7	A	G	6: 114,724,949	D682G	probably damaging	Het
Atp13a3	A	G	16: 30,340,284	I783T	probably damaging	Het
Atp9a	T	C	2: 168,674,888	I362V	probably benign	Het
BC067074	G	A	13: 113,342,413	C1497Y	probably benign	Het
Birc6	T	A	17: 74,613,470	I168K	probably damaging	Het
Brca2	T	A	5: 150,542,980	Y2070N	probably damaging	Het
Cabp7	A	G	11: 4,738,873	I199T	probably damaging	Het
Cacng5	A	G	11: 107,877,489	F231L	possibly damaging	Het
Cngb3	T	A	4: 19,415,729	V413D	possibly damaging	Het
Col24a1	G	A	3: 145,315,310	E481K	possibly damaging	Het
Ctr9	T	A	7: 111,045,458	I560N	possibly damaging	Het
Dip2b	C	T	15: 100,211,986	R1451C	probably damaging	Het
Fat3	T	C	9: 16,377,537	D230G	probably damaging	Het
Gramd4	G	A	15: 86,134,785		probably null	Het
Grb14	C	T	2: 64,917,309	V369I	probably benign	Het
Hoxd1	A	T	2: 74,764,351	N317Y	probably damaging	Het
Kcnc4	A	G	3: 107,439,441	S623P	probably benign	Het
Klhl20	A	G	1: 161,093,679		probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lpin2	C	T	17: 71,242,760	S640L	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Mgll	T	A	6: 88,766,329	C110*	probably null	Het
Mmp14	A	G	14: 54,437,663	N251D	possibly damaging	Het
Olfr393	A	T	11: 73,847,436	S230T	probably damaging	Het
Olfr552	A	G	7: 102,604,821	T156A	probably benign	Het
Olfr857	T	A	9: 19,713,289	V154E	probably benign	Het
Pfkl	T	G	10: 78,009,670	D5A	probably damaging	Het
Pkhd1l1	T	A	15: 44,495,647	Y417*	probably null	Het
Rptor	G	A	11: 119,843,713	G514D	probably damaging	Het
Sulf1	T	A	1: 12,796,874	M94K	probably benign	Het
Synrg	A	G	11: 83,982,196	T157A	probably damaging	Het
Syt1	T	C	10: 108,642,257	N102S	probably benign	Het
Tnip2	C	T	5: 34,503,805	R101H	probably damaging	Het
Trmt2a	A	G	16: 18,252,184	D421G	probably benign	Het
Vmn1r67	A	G	7: 10,447,163	D57G	probably benign	Het
Wnt2b	A	G	3: 104,961,345	L43P	possibly damaging	Het
Zfp113	C	T	5: 138,150,715	D56N	probably damaging	Het
Zfp184	C	T	13: 21,950,236	L69F	probably damaging	Het
Zyx	T	C	6: 42,356,532	V464A	probably damaging	Het

Other mutations in Pik3c3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Pik3c3	APN	18	30303078	splice site	probably benign
IGL00743:Pik3c3	APN	18	30274364	missense	probably damaging	1.00
IGL01622:Pik3c3	APN	18	30290525	nonsense	probably null
IGL01622:Pik3c3	APN	18	30293049	splice site	probably benign
IGL01623:Pik3c3	APN	18	30290525	nonsense	probably null
IGL01623:Pik3c3	APN	18	30293049	splice site	probably benign
IGL01773:Pik3c3	APN	18	30277102	missense	probably damaging	1.00
IGL01917:Pik3c3	APN	18	30274446	missense	probably damaging	1.00
IGL02033:Pik3c3	APN	18	30312650	missense	possibly damaging	0.85
IGL02465:Pik3c3	APN	18	30344060	missense	probably damaging	0.97
IGL03161:Pik3c3	APN	18	30293707	missense	probably benign	0.37
IGL03221:Pik3c3	APN	18	30302931	missense	probably benign	0.45
H8786:Pik3c3	UTSW	18	30294343	missense	probably damaging	0.99
R0089:Pik3c3	UTSW	18	30303078	splice site	probably benign
R1512:Pik3c3	UTSW	18	30322236	critical splice donor site	probably null
R1713:Pik3c3	UTSW	18	30323586	missense	possibly damaging	0.73
R1758:Pik3c3	UTSW	18	30277010	missense	probably damaging	1.00
R1822:Pik3c3	UTSW	18	30344077	critical splice donor site	probably null
R1870:Pik3c3	UTSW	18	30293132	critical splice donor site	probably null
R2680:Pik3c3	UTSW	18	30344078	critical splice donor site	probably null
R3768:Pik3c3	UTSW	18	30333273	missense	probably damaging	1.00
R3926:Pik3c3	UTSW	18	30311329	splice site	probably benign
R4154:Pik3c3	UTSW	18	30311283	missense	probably benign	0.35
R4293:Pik3c3	UTSW	18	30343990	missense	probably damaging	1.00
R4570:Pik3c3	UTSW	18	30290550	missense	possibly damaging	0.94
R4858:Pik3c3	UTSW	18	30344078	critical splice donor site	probably null
R4893:Pik3c3	UTSW	18	30282000	missense	probably benign	0.16
R4901:Pik3c3	UTSW	18	30302929	missense	possibly damaging	0.65
R5358:Pik3c3	UTSW	18	30323544	missense	probably damaging	1.00
R5373:Pik3c3	UTSW	18	30312561	missense	probably benign	0.40
R5374:Pik3c3	UTSW	18	30312561	missense	probably benign	0.40
R5600:Pik3c3	UTSW	18	30311293	missense	probably damaging	1.00
R5680:Pik3c3	UTSW	18	30277113	nonsense	probably null
R5965:Pik3c3	UTSW	18	30298580	missense	probably damaging	1.00
R6492:Pik3c3	UTSW	18	30324562	missense	probably damaging	1.00
R6576:Pik3c3	UTSW	18	30342741	intron	probably benign
R6700:Pik3c3	UTSW	18	30316901	missense	probably benign	0.02
R7523:Pik3c3	UTSW	18	30293655	missense	probably damaging	1.00
R7883:Pik3c3	UTSW	18	30274363	missense	probably benign	0.04
R7884:Pik3c3	UTSW	18	30312571	missense	probably benign	0.00
R7886:Pik3c3	UTSW	18	30319588	nonsense	probably null
R8075:Pik3c3	UTSW	18	30305029	missense	probably damaging	0.99
R9163:Pik3c3	UTSW	18	30294430	critical splice donor site	probably null
R9246:Pik3c3	UTSW	18	30333311	missense	probably damaging	1.00
R9311:Pik3c3	UTSW	18	30312613	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CATTTGCACATGCGTACAGC -3'
(R):5'- GCGGTATTCCCACAAAAGCG -3'

Sequencing Primer
(F):5'- CAGGGGCTGTTCCGTCG -3'
(R):5'- GGAACACGCAAAGGGCTCC -3'

Posted On

2016-07-22