Mutagenetix > Incidental Mutation

Incidental Mutation 'R5217:Gon4l'

403517

Institutional Source

Beutler Lab

Gene Symbol

Gon4l

Ensembl Gene

ENSMUSG00000054199

Gene Name

gon-4-like (C.elegans)

Synonyms

2610100B20Rik, 1500041I23Rik

MMRRC Submission

042790-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.868) question?

Stock #

R5217 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88835231-88910103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88887575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 695 (T695K)

Ref Sequence

ENSEMBL: ENSMUSP00000103122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081695
AA Change: T695K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: T695K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090942
AA Change: T696K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: T696K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	241	257	N/A	INTRINSIC
low complexity region	349	378	N/A	INTRINSIC
low complexity region	433	440	N/A	INTRINSIC
low complexity region	528	543	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
Blast:SANT	814	866	2e-23	BLAST
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1419	1435	N/A	INTRINSIC
low complexity region	1453	1498	N/A	INTRINSIC
low complexity region	1508	1542	N/A	INTRINSIC
Pfam:PAH	1654	1700	2.1e-8	PFAM
low complexity region	1801	1812	N/A	INTRINSIC
coiled coil region	1920	1944	N/A	INTRINSIC
low complexity region	2086	2095	N/A	INTRINSIC
SANT	2154	2205	2.2e-1	SMART
low complexity region	2208	2223	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107498
AA Change: T695K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: T695K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198113

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198251

Predicted Effect

unknown
Transcript: ENSMUST00000212694
AA Change: T395K

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

100% (80/80)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,433,726	L28H	probably damaging	Het
4933428M09Rik	G	T	X: 139,179,533	G16*	probably null	Het
Abhd11	T	A	5: 135,011,544	W144R	probably damaging	Het
Abhd2	A	G	7: 79,323,630	E119G	probably benign	Het
Acbd3	A	G	1: 180,726,373	Y91C	probably benign	Het
Aox4	C	A	1: 58,246,241	S628*	probably null	Het
Bahcc1	T	A	11: 120,274,459	Y905*	probably null	Het
Baiap2l2	T	G	15: 79,270,487	S211R	probably benign	Het
C77080	C	T	4: 129,222,685	E729K	probably damaging	Het
Cab39l	T	A	14: 59,526,809	Y206*	probably null	Het
Cacna1i	A	T	15: 80,390,840	T1830S	possibly damaging	Het
Catsperg1	A	T	7: 29,190,298	L793*	probably null	Het
Cdh10	G	T	15: 18,966,022	V198F	probably damaging	Het
Cenpk	A	T	13: 104,249,409	I271F	probably damaging	Het
Chchd4	A	T	6: 91,465,278	C53S	probably damaging	Het
Cluh	T	G	11: 74,659,705	C252W	probably damaging	Het
Cmklr1	G	T	5: 113,614,649	A97E	probably damaging	Het
Coil	C	A	11: 88,981,161	A116D	possibly damaging	Het
F830045P16Rik	C	A	2: 129,463,573	V294F	probably damaging	Het
Fgd6	T	A	10: 94,134,077	M1196K	possibly damaging	Het
Gabra5	G	A	7: 57,490,856	S31L	probably benign	Het
Gm10264	A	G	12: 88,329,426	H58R	probably benign	Het
Gm7135	A	T	1: 97,435,065		noncoding transcript	Het
Hectd4	A	G	5: 121,353,551	H3684R	possibly damaging	Het
Ica1l	T	A	1: 60,015,758	M105L	probably benign	Het
Igkv8-24	A	T	6: 70,217,402	V7D	probably damaging	Het
Klf10	G	A	15: 38,296,087	R420W	probably damaging	Het
Klrc2	C	A	6: 129,656,880	W177C	probably damaging	Het
Krit1	T	A	5: 3,806,451	C15*	probably null	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lrrc37a	C	T	11: 103,456,954	V2972I	unknown	Het
Mapkapk5	T	C	5: 121,534,429	D13G	probably damaging	Het
Mcph1	T	A	8: 18,788,473	L804I	probably damaging	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mrto4	A	G	4: 139,348,459	Y119H	probably benign	Het
Nbeal2	G	T	9: 110,632,090	A1635E	possibly damaging	Het
Ndc1	T	C	4: 107,389,576	S399P	probably benign	Het
Ndufv2	A	G	17: 66,087,429	I147T	probably damaging	Het
Neb	C	A	2: 52,162,130	E382*	probably null	Het
Nme8	T	A	13: 19,696,691	I32F	probably damaging	Het
Obox5	T	A	7: 15,757,868		probably null	Het
Olfr937	A	G	9: 39,059,769	V299A	probably benign	Het
Pcdhb19	A	T	18: 37,497,886	M245L	probably benign	Het
Pex5l	A	T	3: 33,007,328		probably null	Het
Phrf1	T	G	7: 141,260,703	D1270E	probably damaging	Het
Pik3r5	A	G	11: 68,491,964	K277E	possibly damaging	Het
Ppan	T	C	9: 20,890,925	V204A	possibly damaging	Het
Ppp1r9a	A	T	6: 5,115,367	N830I	probably damaging	Het
Pxn	C	G	5: 115,544,915	A92G	probably benign	Het
Qsox1	A	G	1: 155,790,996	V249A	probably benign	Het
Rgl3	T	A	9: 21,987,648	*88C	probably null	Het
Rps6kc1	A	T	1: 190,783,605	W975R	probably damaging	Het
Sash1	G	T	10: 8,780,604	A208D	possibly damaging	Het
Simc1	A	T	13: 54,539,896		probably benign	Het
Sox7	T	C	14: 63,948,000	Y162H	probably damaging	Het
Srp72	T	A	5: 76,980,528	L171H	probably damaging	Het
Stab1	T	A	14: 31,159,519	Y577F	probably benign	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Tagln	T	C	9: 45,930,879	T139A	probably benign	Het
Thbs3	T	C	3: 89,223,164		probably null	Het
Tmem216	G	A	19: 10,551,791	T131M	possibly damaging	Het
Tmprss11c	A	G	5: 86,256,390	V142A	probably benign	Het
Ttc30a1	A	G	2: 75,980,803	L312P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tusc5	C	G	11: 76,694,276	A164G	possibly damaging	Het
Ubtf	T	C	11: 102,308,302	M511V	probably null	Het
Ugt2b36	A	T	5: 87,066,255	V510E	probably damaging	Het
Vars2	G	C	17: 35,658,149	P887A	probably damaging	Het
Vmn2r80	A	G	10: 79,169,146	M206V	possibly damaging	Het
Zbtb5	A	G	4: 44,993,990	F465L	probably benign	Het
Zfp119a	G	A	17: 55,865,425	Q473*	probably null	Het
Zfp607a	T	G	7: 27,877,844	I113R	probably damaging	Het
Zmym6	C	A	4: 127,105,374	N450K	possibly damaging	Het

Other mutations in Gon4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Gon4l	APN	3	88857185	missense	probably damaging	1.00
IGL02002:Gon4l	APN	3	88895336	missense	possibly damaging	0.46
IGL02065:Gon4l	APN	3	88857210	missense	probably null	1.00
IGL02283:Gon4l	APN	3	88895364	missense	probably damaging	0.99
IGL02669:Gon4l	APN	3	88895499	missense	probably damaging	1.00
IGL03222:Gon4l	APN	3	88895643	missense	possibly damaging	0.56
IGL03385:Gon4l	APN	3	88907543	missense	probably benign	0.10
PIT4581001:Gon4l	UTSW	3	88895514	missense	probably damaging	1.00
R0020:Gon4l	UTSW	3	88858937	missense	probably damaging	1.00
R0115:Gon4l	UTSW	3	88895682	missense	probably damaging	1.00
R0173:Gon4l	UTSW	3	88858403	missense	probably damaging	1.00
R0270:Gon4l	UTSW	3	88858400	missense	probably damaging	1.00
R0961:Gon4l	UTSW	3	88898096	splice site	probably benign
R1017:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R1163:Gon4l	UTSW	3	88892535	missense	probably damaging	1.00
R1729:Gon4l	UTSW	3	88903098	missense	probably damaging	1.00
R1764:Gon4l	UTSW	3	88892599	missense	probably damaging	1.00
R1861:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R2141:Gon4l	UTSW	3	88887595	missense	possibly damaging	0.66
R2347:Gon4l	UTSW	3	88863517	missense	probably damaging	1.00
R2402:Gon4l	UTSW	3	88859043	missense	probably damaging	1.00
R2842:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R4375:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4376:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4377:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4569:Gon4l	UTSW	3	88910090	intron	probably benign
R4650:Gon4l	UTSW	3	88863552	missense	possibly damaging	0.94
R4859:Gon4l	UTSW	3	88895348	missense	probably benign	0.00
R4901:Gon4l	UTSW	3	88908151	missense	possibly damaging	0.50
R4998:Gon4l	UTSW	3	88899998	missense	probably damaging	1.00
R5059:Gon4l	UTSW	3	88900012	missense	probably benign	0.00
R5269:Gon4l	UTSW	3	88895528	missense	probably benign
R5279:Gon4l	UTSW	3	88887637	missense	probably benign
R5283:Gon4l	UTSW	3	88887590	missense	probably damaging	1.00
R5386:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R5433:Gon4l	UTSW	3	88896225	missense	possibly damaging	0.93
R5583:Gon4l	UTSW	3	88899971	missense	probably damaging	1.00
R5695:Gon4l	UTSW	3	88896216	frame shift	probably null
R5921:Gon4l	UTSW	3	88909947	intron	probably benign
R6003:Gon4l	UTSW	3	88896093	missense	probably damaging	0.99
R6063:Gon4l	UTSW	3	88899999	missense	probably damaging	1.00
R6217:Gon4l	UTSW	3	88892661	missense	possibly damaging	0.62
R6273:Gon4l	UTSW	3	88855849	missense	probably damaging	1.00
R6280:Gon4l	UTSW	3	88890888	missense	probably damaging	1.00
R6790:Gon4l	UTSW	3	88858998	missense	probably damaging	1.00
R6829:Gon4l	UTSW	3	88880106	missense	possibly damaging	0.96
R6891:Gon4l	UTSW	3	88858866	splice site	probably null
R7128:Gon4l	UTSW	3	88895692	missense	possibly damaging	0.94
R7315:Gon4l	UTSW	3	88895179	missense	probably benign	0.00
R7355:Gon4l	UTSW	3	88863520	missense	probably damaging	1.00
R7426:Gon4l	UTSW	3	88907522	missense	probably benign
R7635:Gon4l	UTSW	3	88895106	missense	probably benign	0.03
R7643:Gon4l	UTSW	3	88902807	missense	probably damaging	1.00
R7715:Gon4l	UTSW	3	88908006	missense	probably benign
R7773:Gon4l	UTSW	3	88895795	missense	probably benign	0.00
R8090:Gon4l	UTSW	3	88892624	missense	probably damaging	1.00
R8224:Gon4l	UTSW	3	88895142	missense	probably damaging	1.00
R8260:Gon4l	UTSW	3	88892630	missense	probably damaging	0.98
R8434:Gon4l	UTSW	3	88854779	missense	probably damaging	1.00
R8732:Gon4l	UTSW	3	88899984	missense	possibly damaging	0.95
R8812:Gon4l	UTSW	3	88895007	missense	possibly damaging	0.86
R9132:Gon4l	UTSW	3	88908177	missense	probably benign	0.29
R9161:Gon4l	UTSW	3	88901648	missense	probably damaging	1.00
R9187:Gon4l	UTSW	3	88879311	missense	probably benign	0.10
R9212:Gon4l	UTSW	3	88896423	missense	probably benign	0.01
R9338:Gon4l	UTSW	3	88901712	missense	probably benign	0.00
R9387:Gon4l	UTSW	3	88894953	missense	probably benign	0.00
R9416:Gon4l	UTSW	3	88896231	missense	probably benign	0.00
R9607:Gon4l	UTSW	3	88858444	missense	probably damaging	0.99
Z1177:Gon4l	UTSW	3	88859036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTCTCTAGTTTGAGGGTCAAG -3'
(R):5'- TGTCATGCAAACAGAGGAAGTC -3'

Sequencing Primer
(F):5'- CTCTAGTTTGAGGGTCAAGTTTGTC -3'
(R):5'- TCACAGGACAGGCAGGTAC -3'

Posted On

2016-07-22