Incidental Mutation 'R5217:Ugt2b36'
ID403527
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87065927-87092555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87066255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 510 (V510E)
Ref Sequence ENSEMBL: ENSMUSP00000092233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000145617]
Predicted Effect probably damaging
Transcript: ENSMUST00000094649
AA Change: V510E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: V510E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145617
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154455
SMART Domains Protein: ENSMUSP00000120633
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 1 198 1.2e-117 PFAM
Pfam:Glyco_tran_28_C 109 194 1.7e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87081581 missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87080869 critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87080885 missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87090942 missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87080924 missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87090900 missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87092074 missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87091975 missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87089477 missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87066375 missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87091989 missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87092071 missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87092399 missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87081581 missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87080868 critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2066:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87066255 missense possibly damaging 0.65
R2696:Ugt2b36 UTSW 5 87089485 missense probably damaging 1.00
R4626:Ugt2b36 UTSW 5 87092088 missense probably damaging 1.00
R4700:Ugt2b36 UTSW 5 87092442 critical splice donor site probably null
R4731:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4732:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4733:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4922:Ugt2b36 UTSW 5 87066324 missense probably damaging 1.00
R5244:Ugt2b36 UTSW 5 87091906 missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87092228 nonsense probably null
R5478:Ugt2b36 UTSW 5 87089482 missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87089482 missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87092438 nonsense probably null
R5961:Ugt2b36 UTSW 5 87080865 splice site probably null
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87092171 missense probably benign
R6145:Ugt2b36 UTSW 5 87066213 missense probably benign
R6226:Ugt2b36 UTSW 5 87092130 missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87081586 missense probably damaging 1.00
R6704:Ugt2b36 UTSW 5 87092131 missense probably damaging 1.00
R6895:Ugt2b36 UTSW 5 87092298 missense probably benign 0.06
R7218:Ugt2b36 UTSW 5 87081539 missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87080903 missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87066279 missense possibly damaging 0.94
R7650:Ugt2b36 UTSW 5 87080972 missense probably damaging 1.00
R7707:Ugt2b36 UTSW 5 87081508 critical splice donor site probably null
R7866:Ugt2b36 UTSW 5 87092331 missense probably damaging 1.00
R8098:Ugt2b36 UTSW 5 87092393 missense probably benign 0.02
R8123:Ugt2b36 UTSW 5 87092436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGCCCCAGAATTATATGTG -3'
(R):5'- CATTCACCATGACCAGCCTATG -3'

Sequencing Primer
(F):5'- GTAGCCCCAGAATTATATGTGTTTTG -3'
(R):5'- CTATGAAGCCCCTGGACAGAG -3'
Posted On2016-07-22