Incidental Mutation 'R0416:Tapbp'
ID40353
Institutional Source Beutler Lab
Gene Symbol Tapbp
Ensembl Gene ENSMUSG00000024308
Gene NameTAP binding protein
SynonymsTPN, tapasin, D17Wsu91e
MMRRC Submission 038618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0416 (G1)
Quality Score95
Status Validated
Chromosome17
Chromosomal Location33915899-33929288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33925418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000025161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
Predicted Effect probably damaging
Transcript: ENSMUST00000025161
AA Change: T163A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: T163A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172489
SMART Domains Protein: ENSMUSP00000133332
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
IG 18 142 3.45e0 SMART
SCOP:d2fbjh2 143 189 2e-3 SMART
Blast:IG_like 152 206 6e-31 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Meta Mutation Damage Score 0.1283 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,563,556 I18V probably benign Het
Adamdec1 T G 14: 68,568,712 E438A possibly damaging Het
Adamts17 A G 7: 66,915,898 probably null Het
Ankrd44 T G 1: 54,743,339 I359L possibly damaging Het
Ap2s1 C A 7: 16,747,365 N86K probably damaging Het
Arih1 T A 9: 59,426,710 probably benign Het
Astn1 T A 1: 158,509,891 I389N probably damaging Het
Brca2 T C 5: 150,569,392 S3291P possibly damaging Het
Cacna1d T C 14: 30,100,688 probably benign Het
Ccl7 C A 11: 82,045,866 probably benign Het
Cd74 A T 18: 60,811,414 Y232F possibly damaging Het
Cep128 A G 12: 91,230,867 probably benign Het
Cep89 T A 7: 35,416,402 probably benign Het
Cmya5 T G 13: 93,089,856 N2908T probably benign Het
Coil T C 11: 88,981,986 L391S possibly damaging Het
Cpd C T 11: 76,785,204 V1208I probably benign Het
Ddx19a T C 8: 110,979,057 D254G probably damaging Het
Desi2 T A 1: 178,256,321 probably benign Het
Dnah11 A T 12: 117,911,058 M4024K probably damaging Het
Ergic2 A T 6: 148,183,144 L53H probably damaging Het
Etv2 T C 7: 30,634,633 Y225C probably benign Het
F10 G A 8: 13,055,448 A338T probably damaging Het
Fam228b T A 12: 4,762,382 D132V probably damaging Het
Fat2 T A 11: 55,284,134 I1918F possibly damaging Het
Fbxw5 C T 2: 25,503,239 S214F probably damaging Het
Glyat G A 19: 12,651,453 R204Q possibly damaging Het
Gm4825 T C 15: 85,510,981 noncoding transcript Het
Ino80d G T 1: 63,086,276 T9K possibly damaging Het
Lifr A T 15: 7,166,914 D193V probably damaging Het
Lrp12 G T 15: 39,878,911 probably benign Het
Lrp3 A G 7: 35,202,353 V701A probably benign Het
Mfsd11 T A 11: 116,865,882 probably benign Het
Mrto4 A T 4: 139,349,732 probably null Het
Msi1 T C 5: 115,430,649 F43L possibly damaging Het
Mthfsd T C 8: 121,101,237 D168G probably damaging Het
Myo15 T A 11: 60,511,174 V3099E probably damaging Het
Myrf T C 19: 10,215,812 probably null Het
Nadk C A 4: 155,587,799 probably benign Het
Nav1 T C 1: 135,471,126 K573E possibly damaging Het
Ndufs3 A G 2: 90,898,388 V207A probably damaging Het
Nlrp3 T C 11: 59,555,924 probably benign Het
Nlrx1 T G 9: 44,262,914 D330A probably benign Het
Olfr331 T C 11: 58,502,396 I53M unknown Het
Olfr444 G A 6: 42,955,570 C24Y probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pcnx A T 12: 81,974,466 I1410F probably benign Het
Piezo2 G A 18: 63,024,491 R2383C probably damaging Het
Pip5kl1 A T 2: 32,583,424 K358* probably null Het
Polg T C 7: 79,452,240 probably benign Het
Prr14l T A 5: 32,828,717 I1145F probably benign Het
Psmb1 C T 17: 15,494,519 V39I probably benign Het
Ptk6 T C 2: 181,202,308 Y66C possibly damaging Het
Robo4 T C 9: 37,404,766 probably benign Het
Sdk2 A G 11: 113,803,203 Y1801H probably damaging Het
Serpinb3a C A 1: 107,049,386 A95S probably benign Het
Setd1a CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,297 probably benign Het
Sik2 A T 9: 50,995,632 Y98N probably damaging Het
Slc30a1 C T 1: 191,909,726 P495S probably benign Het
Smg1 A T 7: 118,184,461 probably benign Het
Stk3 T A 15: 35,114,632 I45L probably benign Het
Tdrd5 T C 1: 156,285,481 K410E probably damaging Het
Trim30b A T 7: 104,363,766 M152K probably benign Het
Trpm6 G T 19: 18,783,025 probably benign Het
Tsc22d1 T C 14: 76,505,303 probably benign Het
U2surp A T 9: 95,485,607 F444I probably damaging Het
Vmn2r95 C T 17: 18,441,402 P470L probably damaging Het
Zc3h4 T G 7: 16,420,275 Y163D probably damaging Het
Zfp62 A T 11: 49,215,676 H198L probably damaging Het
Zmym1 A G 4: 127,058,820 L56P probably benign Het
Other mutations in Tapbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tapbp APN 17 33919892 missense probably benign
IGL00229:Tapbp APN 17 33925704 missense probably damaging 1.00
R0002:Tapbp UTSW 17 33925632 missense probably damaging 0.98
R0800:Tapbp UTSW 17 33926253 missense probably benign 0.39
R0839:Tapbp UTSW 17 33925743 missense probably benign 0.00
R1584:Tapbp UTSW 17 33919940 unclassified probably null
R1617:Tapbp UTSW 17 33920431 missense probably benign 0.06
R2214:Tapbp UTSW 17 33920326 missense possibly damaging 0.90
R3941:Tapbp UTSW 17 33920483 missense possibly damaging 0.91
R4570:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4571:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4935:Tapbp UTSW 17 33925622 missense probably benign 0.02
R6195:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6233:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6468:Tapbp UTSW 17 33926098 missense probably damaging 1.00
R6736:Tapbp UTSW 17 33919957 missense possibly damaging 0.85
R7139:Tapbp UTSW 17 33920048 missense possibly damaging 0.46
R7146:Tapbp UTSW 17 33925487 missense possibly damaging 0.93
R7233:Tapbp UTSW 17 33919969 missense probably damaging 0.99
R7448:Tapbp UTSW 17 33920417 missense possibly damaging 0.70
R7630:Tapbp UTSW 17 33920344 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGCACGACGAAATTTTATTGTGCCC -3'
(R):5'- GCAAATGCCGTAGCCTTTTCCTG -3'

Sequencing Primer
(F):5'- ATTGTGCCCTTAGAGATCCG -3'
(R):5'- GTGGCAGCCAACAGCAG -3'
Posted On2013-05-23