Incidental Mutation 'R5217:Ppp1r9a'
ID403533
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 9A
SynonymsA230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik
MMRRC Submission 042790-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R5217 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4902917-5165661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5115367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 830 (N830I)
Ref Sequence ENSEMBL: ENSMUSP00000134943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
Predicted Effect probably damaging
Transcript: ENSMUST00000035813
AA Change: N830I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: N830I

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect probably damaging
Transcript: ENSMUST00000175889
AA Change: N830I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: N830I

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176136
Predicted Effect possibly damaging
Transcript: ENSMUST00000176263
AA Change: N852I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: N852I

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177153
AA Change: N830I

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: N830I

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177456
AA Change: N830I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: N830I

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Meta Mutation Damage Score 0.1081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Bahcc1 T A 11: 120,274,459 Y905* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5158195 missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5157014 missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5157023 missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5115322 missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5064003 missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5158248 nonsense probably null
IGL02126:Ppp1r9a APN 6 5156229 missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4906537 missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5046015 missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5110993 splice site probably benign
R0545:Ppp1r9a UTSW 6 5115357 missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4906795 missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5159697 missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5057557 missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5113712 nonsense probably null
R1545:Ppp1r9a UTSW 6 5156242 critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4906168 missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5111060 splice site probably benign
R1834:Ppp1r9a UTSW 6 5113710 missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4906348 missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5154074 missense probably benign
R2227:Ppp1r9a UTSW 6 5154074 missense probably benign
R2898:Ppp1r9a UTSW 6 4906558 missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5113674 missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4906259 unclassified probably benign
R3927:Ppp1r9a UTSW 6 5057531 missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4906537 missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4905477 missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5157016 missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5156177 missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5159702 missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5134363 intron probably benign
R5828:Ppp1r9a UTSW 6 5158200 missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5159648 missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5157002 critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5134660 missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4906363 missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4905509 missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5110715 intron probably benign
R6175:Ppp1r9a UTSW 6 4905639 nonsense probably null
R6188:Ppp1r9a UTSW 6 5158113 nonsense probably null
R6233:Ppp1r9a UTSW 6 5077610 missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5115151 missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5057458 missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4905827 missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5045949 missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4905670 missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5134804 missense probably benign
R7238:Ppp1r9a UTSW 6 5159716 missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5115378 missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4905775 missense probably damaging 1.00
R7666:Ppp1r9a UTSW 6 5143238 missense probably benign 0.00
R7698:Ppp1r9a UTSW 6 4906430 missense probably benign
R7850:Ppp1r9a UTSW 6 4905894 missense possibly damaging 0.77
R8029:Ppp1r9a UTSW 6 5057518 missense possibly damaging 0.76
R8392:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R8411:Ppp1r9a UTSW 6 5057568 missense probably damaging 1.00
R8431:Ppp1r9a UTSW 6 5115456 missense probably benign 0.01
R8699:Ppp1r9a UTSW 6 5115474 missense probably benign 0.00
R8708:Ppp1r9a UTSW 6 5115196 missense probably damaging 1.00
RF007:Ppp1r9a UTSW 6 4906657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCCAAGGCCTGCAAGTTC -3'
(R):5'- TTGACACTCATGGGAGGCAG -3'

Sequencing Primer
(F):5'- CCTGCAAGTTCGGGTGAG -3'
(R):5'- AGTTTGAGCTCTGCAATCTCCAAG -3'
Posted On2016-07-22