Incidental Mutation 'R5217:Bahcc1'
ID403558
Institutional Source Beutler Lab
Gene Symbol Bahcc1
Ensembl Gene ENSMUSG00000039741
Gene NameBAH domain and coiled-coil containing 1
SynonymsKIAA1447
MMRRC Submission 042790-MU
Accession Numbers

Genbank: NM_198423; MGI: 2679272

Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R5217 (G1)
Quality Score167
Status Validated
Chromosome11
Chromosomal Location120232947-120292296 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 120274459 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 905 (Y905*)
Ref Sequence ENSEMBL: ENSMUSP00000112827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044985] [ENSMUST00000118987] [ENSMUST00000122148]
Predicted Effect probably null
Transcript: ENSMUST00000044985
AA Change: Y905*
SMART Domains Protein: ENSMUSP00000043643
Gene: ENSMUSG00000039741
AA Change: Y905*

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118987
AA Change: Y905*
SMART Domains Protein: ENSMUSP00000112784
Gene: ENSMUSG00000039741
AA Change: Y905*

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122148
AA Change: Y905*
SMART Domains Protein: ENSMUSP00000112827
Gene: ENSMUSG00000039741
AA Change: Y905*

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197891
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality for the majority of mutants. Those that survive exhibit hind leg motor dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(2) Gene trapped(24)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,433,726 L28H probably damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
Abhd11 T A 5: 135,011,544 W144R probably damaging Het
Abhd2 A G 7: 79,323,630 E119G probably benign Het
Acbd3 A G 1: 180,726,373 Y91C probably benign Het
Aox4 C A 1: 58,246,241 S628* probably null Het
Baiap2l2 T G 15: 79,270,487 S211R probably benign Het
C77080 C T 4: 129,222,685 E729K probably damaging Het
Cab39l T A 14: 59,526,809 Y206* probably null Het
Cacna1i A T 15: 80,390,840 T1830S possibly damaging Het
Catsperg1 A T 7: 29,190,298 L793* probably null Het
Cdh10 G T 15: 18,966,022 V198F probably damaging Het
Cenpk A T 13: 104,249,409 I271F probably damaging Het
Chchd4 A T 6: 91,465,278 C53S probably damaging Het
Cluh T G 11: 74,659,705 C252W probably damaging Het
Cmklr1 G T 5: 113,614,649 A97E probably damaging Het
Coil C A 11: 88,981,161 A116D possibly damaging Het
F830045P16Rik C A 2: 129,463,573 V294F probably damaging Het
Fgd6 T A 10: 94,134,077 M1196K possibly damaging Het
Gabra5 G A 7: 57,490,856 S31L probably benign Het
Gm10264 A G 12: 88,329,426 H58R probably benign Het
Gm7135 A T 1: 97,435,065 noncoding transcript Het
Gon4l C A 3: 88,887,575 T695K probably damaging Het
Hectd4 A G 5: 121,353,551 H3684R possibly damaging Het
Ica1l T A 1: 60,015,758 M105L probably benign Het
Igkv8-24 A T 6: 70,217,402 V7D probably damaging Het
Klf10 G A 15: 38,296,087 R420W probably damaging Het
Klrc2 C A 6: 129,656,880 W177C probably damaging Het
Krit1 T A 5: 3,806,451 C15* probably null Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrrc37a C T 11: 103,456,954 V2972I unknown Het
Mapkapk5 T C 5: 121,534,429 D13G probably damaging Het
Mcph1 T A 8: 18,788,473 L804I probably damaging Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mrto4 A G 4: 139,348,459 Y119H probably benign Het
Nbeal2 G T 9: 110,632,090 A1635E possibly damaging Het
Ndc1 T C 4: 107,389,576 S399P probably benign Het
Ndufv2 A G 17: 66,087,429 I147T probably damaging Het
Neb C A 2: 52,162,130 E382* probably null Het
Nme8 T A 13: 19,696,691 I32F probably damaging Het
Obox5 T A 7: 15,757,868 probably null Het
Olfr937 A G 9: 39,059,769 V299A probably benign Het
Pcdhb19 A T 18: 37,497,886 M245L probably benign Het
Pex5l A T 3: 33,007,328 probably null Het
Phrf1 T G 7: 141,260,703 D1270E probably damaging Het
Pik3r5 A G 11: 68,491,964 K277E possibly damaging Het
Ppan T C 9: 20,890,925 V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 N830I probably damaging Het
Pxn C G 5: 115,544,915 A92G probably benign Het
Qsox1 A G 1: 155,790,996 V249A probably benign Het
Rgl3 T A 9: 21,987,648 *88C probably null Het
Rps6kc1 A T 1: 190,783,605 W975R probably damaging Het
Sash1 G T 10: 8,780,604 A208D possibly damaging Het
Simc1 A T 13: 54,539,896 probably benign Het
Sox7 T C 14: 63,948,000 Y162H probably damaging Het
Srp72 T A 5: 76,980,528 L171H probably damaging Het
Stab1 T A 14: 31,159,519 Y577F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tagln T C 9: 45,930,879 T139A probably benign Het
Thbs3 T C 3: 89,223,164 probably null Het
Tmem216 G A 19: 10,551,791 T131M possibly damaging Het
Tmprss11c A G 5: 86,256,390 V142A probably benign Het
Ttc30a1 A G 2: 75,980,803 L312P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc5 C G 11: 76,694,276 A164G possibly damaging Het
Ubtf T C 11: 102,308,302 M511V probably null Het
Ugt2b36 A T 5: 87,066,255 V510E probably damaging Het
Vars2 G C 17: 35,658,149 P887A probably damaging Het
Vmn2r80 A G 10: 79,169,146 M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 F465L probably benign Het
Zfp119a G A 17: 55,865,425 Q473* probably null Het
Zfp607a T G 7: 27,877,844 I113R probably damaging Het
Zmym6 C A 4: 127,105,374 N450K possibly damaging Het
Other mutations in Bahcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bahcc1 APN 11 120272304 missense probably damaging 1.00
IGL00536:Bahcc1 APN 11 120285045 missense probably damaging 0.96
IGL01339:Bahcc1 APN 11 120289512 missense probably damaging 1.00
IGL01695:Bahcc1 APN 11 120276609 missense probably benign 0.02
IGL01744:Bahcc1 APN 11 120271737 missense probably benign 0.02
IGL01769:Bahcc1 APN 11 120280204 splice site probably benign
IGL01982:Bahcc1 APN 11 120287473 missense probably damaging 1.00
IGL02341:Bahcc1 APN 11 120272520 missense probably damaging 1.00
IGL02535:Bahcc1 APN 11 120287536 missense possibly damaging 0.88
IGL02559:Bahcc1 APN 11 120285172 missense probably damaging 0.97
IGL02579:Bahcc1 APN 11 120285349 splice site probably benign
IGL02609:Bahcc1 APN 11 120289398 missense possibly damaging 0.93
IGL02678:Bahcc1 APN 11 120272871 missense probably damaging 1.00
IGL02800:Bahcc1 APN 11 120272934 missense probably damaging 1.00
IGL02963:Bahcc1 APN 11 120274932 missense possibly damaging 0.86
IGL03128:Bahcc1 APN 11 120268434 splice site probably benign
IGL03242:Bahcc1 APN 11 120268300 splice site probably benign
IGL03248:Bahcc1 APN 11 120268409 missense probably damaging 1.00
Dimensionality UTSW 11 120273009 missense probably damaging 1.00
R0019:Bahcc1 UTSW 11 120289771 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0148:Bahcc1 UTSW 11 120268404 missense probably damaging 1.00
R0164:Bahcc1 UTSW 11 120285074 splice site probably benign
R0321:Bahcc1 UTSW 11 120273425 critical splice donor site probably null
R0671:Bahcc1 UTSW 11 120287320 missense probably damaging 1.00
R0737:Bahcc1 UTSW 11 120272841 missense probably damaging 1.00
R1452:Bahcc1 UTSW 11 120282239 splice site probably benign
R1570:Bahcc1 UTSW 11 120272183 missense possibly damaging 0.74
R1914:Bahcc1 UTSW 11 120285399 missense probably damaging 1.00
R2010:Bahcc1 UTSW 11 120272778 missense probably damaging 1.00
R2075:Bahcc1 UTSW 11 120271689 missense probably damaging 1.00
R2085:Bahcc1 UTSW 11 120288082 missense probably damaging 1.00
R3552:Bahcc1 UTSW 11 120276772 missense possibly damaging 0.90
R3711:Bahcc1 UTSW 11 120275097 missense probably benign 0.27
R3804:Bahcc1 UTSW 11 120283358 missense probably benign 0.01
R4349:Bahcc1 UTSW 11 120259201 missense probably damaging 1.00
R4557:Bahcc1 UTSW 11 120275088 missense probably damaging 1.00
R4801:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4802:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4908:Bahcc1 UTSW 11 120287754 missense probably benign 0.36
R4941:Bahcc1 UTSW 11 120286665 missense probably benign
R5241:Bahcc1 UTSW 11 120271403 missense probably damaging 1.00
R5432:Bahcc1 UTSW 11 120287988 missense probably benign 0.02
R5696:Bahcc1 UTSW 11 120273987 missense probably damaging 1.00
R5724:Bahcc1 UTSW 11 120285366 missense possibly damaging 0.78
R5725:Bahcc1 UTSW 11 120274888 missense probably benign
R5788:Bahcc1 UTSW 11 120286352 missense probably damaging 1.00
R5893:Bahcc1 UTSW 11 120285430 missense probably damaging 0.99
R5900:Bahcc1 UTSW 11 120284493 missense probably damaging 1.00
R6014:Bahcc1 UTSW 11 120289789 missense probably benign 0.00
R6058:Bahcc1 UTSW 11 120287385 missense probably damaging 1.00
R6107:Bahcc1 UTSW 11 120272888 missense probably benign 0.00
R6302:Bahcc1 UTSW 11 120276808 missense probably damaging 1.00
R6525:Bahcc1 UTSW 11 120285222 missense probably damaging 1.00
R6550:Bahcc1 UTSW 11 120276651 missense possibly damaging 0.94
R6822:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R6836:Bahcc1 UTSW 11 120271757 nonsense probably null
R6846:Bahcc1 UTSW 11 120271596 missense possibly damaging 0.92
R6916:Bahcc1 UTSW 11 120273009 missense probably damaging 1.00
R6966:Bahcc1 UTSW 11 120283159 missense probably damaging 0.99
R7097:Bahcc1 UTSW 11 120272646 missense possibly damaging 0.87
R7289:Bahcc1 UTSW 11 120280174 missense probably benign 0.08
R7441:Bahcc1 UTSW 11 120286306 missense probably damaging 0.99
R7520:Bahcc1 UTSW 11 120276205 missense possibly damaging 0.47
R7556:Bahcc1 UTSW 11 120287763 missense probably damaging 1.00
R7672:Bahcc1 UTSW 11 120283346 missense possibly damaging 0.63
X0026:Bahcc1 UTSW 11 120271752 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGAGAGTTGTATGGCTTATCTTCCC -3'
(R):5'- AACTGGGCAACTCGCTGTAG -3'

Sequencing Primer
(F):5'- GTATGGCTTATCTTCCCAGGGAC -3'
(R):5'- AACTCGCTGTAGCTCCAGG -3'
Posted On2016-07-22