Incidental Mutation 'R5217:Cacna1i'
ID 403570
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 042790-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5217 (G1)
Quality Score 157
Status Validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80275041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1830 (T1830S)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect unknown
Transcript: ENSMUST00000160175
AA Change: T119S
SMART Domains Protein: ENSMUSP00000123881
Gene: ENSMUSG00000022416
AA Change: T119S

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160424
AA Change: T1830S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: T1830S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161863
AA Change: T106S
SMART Domains Protein: ENSMUSP00000124367
Gene: ENSMUSG00000022416
AA Change: T106S

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162025
AA Change: T79S
SMART Domains Protein: ENSMUSP00000125530
Gene: ENSMUSG00000022416
AA Change: T79S

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 87 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162155
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162913
SMART Domains Protein: ENSMUSP00000125617
Gene: ENSMUSG00000022416

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Meta Mutation Damage Score 0.1656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933428M09Rik G T X: 138,080,282 (GRCm39) G16* probably null Het
Abhd11 T A 5: 135,040,398 (GRCm39) W144R probably damaging Het
Abhd2 A G 7: 78,973,378 (GRCm39) E119G probably benign Het
Acbd3 A G 1: 180,553,938 (GRCm39) Y91C probably benign Het
Aox4 C A 1: 58,285,400 (GRCm39) S628* probably null Het
Bahcc1 T A 11: 120,165,285 (GRCm39) Y905* probably null Het
Baiap2l2 T G 15: 79,154,687 (GRCm39) S211R probably benign Het
Cab39l T A 14: 59,764,258 (GRCm39) Y206* probably null Het
Catsperg1 A T 7: 28,889,723 (GRCm39) L793* probably null Het
Cdh10 G T 15: 18,966,108 (GRCm39) V198F probably damaging Het
Cenpk A T 13: 104,385,917 (GRCm39) I271F probably damaging Het
Chchd4 A T 6: 91,442,260 (GRCm39) C53S probably damaging Het
Cluh T G 11: 74,550,531 (GRCm39) C252W probably damaging Het
Cmklr1 G T 5: 113,752,710 (GRCm39) A97E probably damaging Het
Coil C A 11: 88,871,987 (GRCm39) A116D possibly damaging Het
Eif1ad9 A G 12: 88,296,196 (GRCm39) H58R probably benign Het
F830045P16Rik C A 2: 129,305,493 (GRCm39) V294F probably damaging Het
Fgd6 T A 10: 93,969,939 (GRCm39) M1196K possibly damaging Het
Gabra5 G A 7: 57,140,604 (GRCm39) S31L probably benign Het
Gm7135 A T 1: 97,362,790 (GRCm39) noncoding transcript Het
Gon4l C A 3: 88,794,882 (GRCm39) T695K probably damaging Het
Hectd4 A G 5: 121,491,614 (GRCm39) H3684R possibly damaging Het
Ica1l T A 1: 60,054,917 (GRCm39) M105L probably benign Het
Ift70a1 A G 2: 75,811,147 (GRCm39) L312P probably damaging Het
Igkv8-24 A T 6: 70,194,386 (GRCm39) V7D probably damaging Het
Klf10 G A 15: 38,296,331 (GRCm39) R420W probably damaging Het
Klrc2 C A 6: 129,633,843 (GRCm39) W177C probably damaging Het
Krit1 T A 5: 3,856,451 (GRCm39) C15* probably null Het
Lamc1 C A 1: 153,103,442 (GRCm39) V1375L probably damaging Het
Lrrc37a C T 11: 103,347,780 (GRCm39) V2972I unknown Het
Mapkapk5 T C 5: 121,672,492 (GRCm39) D13G probably damaging Het
Mcph1 T A 8: 18,838,489 (GRCm39) L804I probably damaging Het
Mdn1 C T 4: 32,723,690 (GRCm39) P2542L probably damaging Het
Mrto4 A G 4: 139,075,770 (GRCm39) Y119H probably benign Het
Nbeal2 G T 9: 110,461,158 (GRCm39) A1635E possibly damaging Het
Ndc1 T C 4: 107,246,773 (GRCm39) S399P probably benign Het
Ndufv2 A G 17: 66,394,424 (GRCm39) I147T probably damaging Het
Neb C A 2: 52,052,142 (GRCm39) E382* probably null Het
Nhsl3 C T 4: 129,116,478 (GRCm39) E729K probably damaging Het
Nme8 T A 13: 19,880,861 (GRCm39) I32F probably damaging Het
Obox5 T A 7: 15,491,793 (GRCm39) probably null Het
Or8g23 A G 9: 38,971,065 (GRCm39) V299A probably benign Het
Pcdhb19 A T 18: 37,630,939 (GRCm39) M245L probably benign Het
Pex5l A T 3: 33,061,477 (GRCm39) probably null Het
Phrf1 T G 7: 140,840,616 (GRCm39) D1270E probably damaging Het
Pik3r5 A G 11: 68,382,790 (GRCm39) K277E possibly damaging Het
Ppan T C 9: 20,802,221 (GRCm39) V204A possibly damaging Het
Ppp1r9a A T 6: 5,115,367 (GRCm39) N830I probably damaging Het
Pxn C G 5: 115,682,974 (GRCm39) A92G probably benign Het
Qsox1 A G 1: 155,666,742 (GRCm39) V249A probably benign Het
Rgl3 T A 9: 21,898,944 (GRCm39) *88C probably null Het
Rps6kc1 A T 1: 190,515,802 (GRCm39) W975R probably damaging Het
Sash1 G T 10: 8,656,368 (GRCm39) A208D possibly damaging Het
Simc1 A T 13: 54,687,709 (GRCm39) probably benign Het
Sox7 T C 14: 64,185,449 (GRCm39) Y162H probably damaging Het
Srp72 T A 5: 77,128,375 (GRCm39) L171H probably damaging Het
Stab1 T A 14: 30,881,476 (GRCm39) Y577F probably benign Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Tagln T C 9: 45,842,177 (GRCm39) T139A probably benign Het
Thbs3 T C 3: 89,130,471 (GRCm39) probably null Het
Tmem216 G A 19: 10,529,155 (GRCm39) T131M possibly damaging Het
Tmprss11c A G 5: 86,404,249 (GRCm39) V142A probably benign Het
Trarg1 C G 11: 76,585,102 (GRCm39) A164G possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubtf T C 11: 102,199,128 (GRCm39) M511V probably null Het
Ugt2b36 A T 5: 87,214,114 (GRCm39) V510E probably damaging Het
Vars2 G C 17: 35,969,041 (GRCm39) P887A probably damaging Het
Vmn2r80 A G 10: 79,004,980 (GRCm39) M206V possibly damaging Het
Zbtb5 A G 4: 44,993,990 (GRCm39) F465L probably benign Het
Zfp119a G A 17: 56,172,425 (GRCm39) Q473* probably null Het
Zfp607a T G 7: 27,577,269 (GRCm39) I113R probably damaging Het
Zfp998 A T 13: 66,581,787 (GRCm39) L28H probably damaging Het
Zmym6 C A 4: 126,999,167 (GRCm39) N450K possibly damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCTCATATGTCACCCAGGCTG -3'
(R):5'- CATTAACCTGAGCCTGAGCC -3'

Sequencing Primer
(F):5'- GCTGGGATCCTACACAGAGTG -3'
(R):5'- TGAGCCTGAGCCCAACCTG -3'
Posted On 2016-07-22