Incidental Mutation 'R5218:Ppig'
ID403583
Institutional Source Beutler Lab
Gene Symbol Ppig
Ensembl Gene ENSMUSG00000042133
Gene Namepeptidyl-prolyl isomerase G (cyclophilin G)
SynonymsSRCyp, B230312B02Rik
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69722545-69754012 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 69732783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040915] [ENSMUST00000090858] [ENSMUST00000144652]
Predicted Effect probably benign
Transcript: ENSMUST00000040915
SMART Domains Protein: ENSMUSP00000045945
Gene: ENSMUSG00000042133

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.8e-50 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000090858
SMART Domains Protein: ENSMUSP00000088370
Gene: ENSMUSG00000042133

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.7e-49 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142839
Predicted Effect probably benign
Transcript: ENSMUST00000144652
SMART Domains Protein: ENSMUSP00000114570
Gene: ENSMUSG00000042133

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 127 8.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146234
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Ppig
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Ppig APN 2 69749716 missense unknown
IGL00780:Ppig APN 2 69732924 missense possibly damaging 0.89
IGL02043:Ppig APN 2 69735983 splice site probably null
IGL02420:Ppig APN 2 69732227 missense probably benign 0.03
IGL02736:Ppig APN 2 69736094 missense probably damaging 1.00
R0358:Ppig UTSW 2 69743598 splice site probably benign
R0396:Ppig UTSW 2 69735976 unclassified probably benign
R1035:Ppig UTSW 2 69749459 missense unknown
R1159:Ppig UTSW 2 69750224 missense unknown
R1396:Ppig UTSW 2 69749018 missense unknown
R1593:Ppig UTSW 2 69749081 missense unknown
R1629:Ppig UTSW 2 69735873 missense probably damaging 1.00
R1799:Ppig UTSW 2 69749400 missense unknown
R2001:Ppig UTSW 2 69741644 missense unknown
R2112:Ppig UTSW 2 69750107 missense unknown
R3702:Ppig UTSW 2 69733209 missense probably damaging 1.00
R3855:Ppig UTSW 2 69749375 missense unknown
R4999:Ppig UTSW 2 69741486 missense unknown
R5001:Ppig UTSW 2 69741486 missense unknown
R5153:Ppig UTSW 2 69749650 missense unknown
R5336:Ppig UTSW 2 69750224 missense unknown
R5410:Ppig UTSW 2 69735897 missense probably null 1.00
R5443:Ppig UTSW 2 69734291 missense probably damaging 1.00
R5513:Ppig UTSW 2 69750359 missense probably benign 0.23
R6179:Ppig UTSW 2 69750127 missense unknown
R6333:Ppig UTSW 2 69749558 missense unknown
R6604:Ppig UTSW 2 69741581 missense unknown
R6932:Ppig UTSW 2 69732411 missense probably benign 0.40
R7206:Ppig UTSW 2 69741566 missense unknown
R7220:Ppig UTSW 2 69749976 missense unknown
R7308:Ppig UTSW 2 69749462 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTCTGGGCCACATGCAAGG -3'
(R):5'- ACTCAGGATAGTAAACGCAGTC -3'

Sequencing Primer
(F):5'- CATGCAAGGGGGCCTGTAATC -3'
(R):5'- GAGGACTGACTCTTGTAAATTGTCC -3'
Posted On2016-07-22