Incidental Mutation 'R5218:Disp3'
ID403592
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Namedispatched RND transporter family member 3
SynonymsPtchd2, G630052C06Rik
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148240264-148287965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148242876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1184 (S1184G)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: S1184G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: S1184G

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148241534 missense probably benign 0.10
IGL01065:Disp3 APN 4 148261183 missense probably damaging 1.00
IGL01800:Disp3 APN 4 148249801 nonsense probably null
IGL01947:Disp3 APN 4 148260519 missense probably damaging 1.00
IGL02510:Disp3 APN 4 148252701 missense probably benign 0.00
IGL02573:Disp3 APN 4 148271449 missense probably damaging 1.00
IGL02728:Disp3 APN 4 148272038 missense probably damaging 1.00
IGL02931:Disp3 APN 4 148249201 missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0257:Disp3 UTSW 4 148250754 missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148271959 missense probably damaging 1.00
R0557:Disp3 UTSW 4 148241404 missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148241590 missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148249825 missense probably benign 0.00
R1526:Disp3 UTSW 4 148259916 missense probably benign 0.00
R1791:Disp3 UTSW 4 148241518 missense probably damaging 1.00
R1856:Disp3 UTSW 4 148271632 missense probably damaging 1.00
R1987:Disp3 UTSW 4 148258753 missense probably damaging 0.97
R2030:Disp3 UTSW 4 148259966 missense probably damaging 1.00
R2271:Disp3 UTSW 4 148271602 missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148258795 missense probably damaging 1.00
R2566:Disp3 UTSW 4 148241423 missense probably damaging 1.00
R3731:Disp3 UTSW 4 148252827 missense probably benign 0.03
R4359:Disp3 UTSW 4 148271932 missense probably benign 0.03
R4762:Disp3 UTSW 4 148272118 missense probably damaging 1.00
R4950:Disp3 UTSW 4 148258126 missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148244216 missense possibly damaging 0.79
R5523:Disp3 UTSW 4 148258097 missense probably benign 0.14
R5556:Disp3 UTSW 4 148258157 missense probably benign 0.14
R5857:Disp3 UTSW 4 148249183 missense probably benign 0.01
R5933:Disp3 UTSW 4 148241313 nonsense probably null
R5994:Disp3 UTSW 4 148254284 missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148254308 missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148259930 missense probably benign 0.09
R7211:Disp3 UTSW 4 148241522 missense probably damaging 0.98
R7470:Disp3 UTSW 4 148261070 missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148242866 missense probably damaging 0.99
Z1088:Disp3 UTSW 4 148271743 missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148250957 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249746 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148249847 missense probably benign 0.01
Z1177:Disp3 UTSW 4 148250714 missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148270567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCATCTGTCCTTAGGGG -3'
(R):5'- GGCATCCTGTAGGTGTGACATG -3'

Sequencing Primer
(F):5'- TGCCATTGTCCCAAGGTG -3'
(R):5'- ACATGTTGCTGTGTCTGCGTTC -3'
Posted On2016-07-22