Incidental Mutation 'R5218:Flt1'
ID403595
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147681928 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 199 (T199M)
Ref Sequence ENSEMBL: ENSMUSP00000106158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031652
SMART Domains Protein: ENSMUSP00000031652
Gene: ENSMUSG00000029648

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
Pfam:Ig_2 434 511 9.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031653
AA Change: T199M

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: T199M

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110529
AA Change: T199M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: T199M

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Meta Mutation Damage Score 0.1826 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTAGGATTGTATTGGCTGCAAG -3'
(R):5'- GGAACAAACCGGCGTTTTG -3'

Sequencing Primer
(F):5'- GCTGCAAGCACAAGAGGG -3'
(R):5'- ACAAACCGGCGTTTTGACCTG -3'
Posted On2016-07-22