Mutagenetix > Incidental Mutations

Incidental Mutation 'R5218:Ptprh'

403599

Institutional Source

Beutler Lab

Gene Symbol

Ptprh

Ensembl Gene

ENSMUSG00000035429

Gene Name

protein tyrosine phosphatase, receptor type, H

Synonyms

SAP-1

MMRRC Submission

042791-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5218 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4548612-4604041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4597920 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 153 (S153G)

Ref Sequence

ENSEMBL: ENSMUSP00000145543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]

Predicted Effect

probably benign
Transcript: ENSMUST00000049113
AA Change: S153G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: S153G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166650
AA Change: S153G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: S153G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FN3	67	145	2.42e-9	SMART
FN3	156	234	9.69e-9	SMART
FN3	245	323	1.57e-8	SMART
FN3	334	412	6.29e-8	SMART
FN3	427	505	7.75e-8	SMART
FN3	516	593	1.21e0	SMART
transmembrane domain	605	627	N/A	INTRINSIC
PTPc	670	932	1.09e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205341

Predicted Effect

probably benign
Transcript: ENSMUST00000206999
AA Change: S153G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	T	A	14: 32,816,836		probably null	Het
4921524L21Rik	T	A	18: 6,629,628	N230K	possibly damaging	Het
4933428M09Rik	G	T	X: 139,179,533	G16*	probably null	Het
5830473C10Rik	A	G	5: 90,581,918	K400R	probably benign	Het
Amigo1	A	G	3: 108,187,770		probably null	Het
Arhgap30	A	T	1: 171,408,760	T901S	probably benign	Het
Arpp21	T	C	9: 112,143,431	D264G	probably damaging	Het
Ccbe1	C	T	18: 66,083,158	G165S	probably damaging	Het
Celsr1	T	C	15: 85,932,384	D1786G	probably damaging	Het
Cntn1	T	C	15: 92,339,549	L1008P	unknown	Het
Dclk2	T	A	3: 86,805,678	D489V	probably damaging	Het
Dip2b	T	A	15: 100,154,296	D259E	probably benign	Het
Disp3	T	C	4: 148,242,876	S1184G	possibly damaging	Het
Dync1li2	C	T	8: 104,442,547	W36*	probably null	Het
Ece2	A	T	16: 20,618,540	M211L	probably benign	Het
Edn3	C	T	2: 174,761,552	A31V	probably benign	Het
Enpp2	T	C	15: 54,887,586	Q266R	possibly damaging	Het
Fabp1	C	A	6: 71,199,960	Q12K	probably damaging	Het
Flt1	G	A	5: 147,681,928	T199M	probably damaging	Het
Galns	T	A	8: 122,598,589	I275F	probably damaging	Het
Gapvd1	T	C	2: 34,728,476	D295G	probably benign	Het
Gatb	A	G	3: 85,604,444	I169V	probably benign	Het
Gpd1	T	A	15: 99,720,130	I109N	probably damaging	Het
Gps2	T	C	11: 69,916,295		probably null	Het
Hsd17b12	T	C	2: 94,083,263	N99D	probably benign	Het
Itga3	A	T	11: 95,062,748	V256E	probably benign	Het
Kcnma1	T	A	14: 23,463,185	Y527F	probably damaging	Het
Lamc1	C	A	1: 153,227,696	V1375L	probably damaging	Het
Lrp1	C	A	10: 127,548,619	E3580D	probably damaging	Het
Ltbp4	AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC	AATTCAGGCCTAGGCTGGGATTCAGGC	7: 27,327,311		probably benign	Het
Medag	A	T	5: 149,422,254		probably benign	Het
Ncdn	C	A	4: 126,750,810	R73L	probably benign	Het
Nr4a1	T	C	15: 101,272,153	V339A	probably benign	Het
Ocln	G	T	13: 100,506,314	P420Q	probably damaging	Het
Olfr206	A	T	16: 59,344,907	S265T	probably benign	Het
Pank4	C	T	4: 154,979,728	T681I	probably benign	Het
Pcdhb6	T	A	18: 37,334,335	V103E	possibly damaging	Het
Pcsk6	T	C	7: 66,025,288	F469S	probably benign	Het
Phrf1	A	G	7: 141,261,301	N1353S	possibly damaging	Het
Pou6f2	A	G	13: 18,152,001	I72T	probably damaging	Het
Ppig	T	C	2: 69,732,783		probably benign	Het
Rab11b	T	C	17: 33,748,950	N91S	probably benign	Het
Scara5	CG	C	14: 65,759,662		probably null	Het
Slc2a9	A	G	5: 38,453,181	S92P	probably damaging	Het
Slit3	G	A	11: 35,684,175		probably null	Het
Sox5	T	C	6: 143,960,890	I280V	possibly damaging	Het
Stam2	G	A	2: 52,736,293		probably benign	Het
Tdrd9	C	T	12: 112,063,475		probably benign	Het
Tmem74	A	T	15: 43,867,244	N134K	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Txnl1	T	G	18: 63,679,467	K85N	probably benign	Het
Vmn2r77	T	A	7: 86,802,133	M409K	probably damaging	Het
Wipf1	T	C	2: 73,444,468	D53G	probably damaging	Het
Wnt10a	G	A	1: 74,793,595	V116I	probably benign	Het
Xpot	T	A	10: 121,619,138	D33V	probably damaging	Het
Znrf3	C	T	11: 5,281,519	V665M	possibly damaging	Het

Other mutations in Ptprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01766:Ptprh	APN	7	4580916	missense	probably benign	0.23
IGL02420:Ptprh	APN	7	4580930	missense	probably damaging	1.00
IGL02619:Ptprh	APN	7	4549499	missense	probably damaging	1.00
IGL02729:Ptprh	APN	7	4580874	missense	probably damaging	0.99
R0018:Ptprh	UTSW	7	4601846	critical splice donor site	probably null
R0049:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R0449:Ptprh	UTSW	7	4598006	missense	probably damaging	1.00
R0477:Ptprh	UTSW	7	4597998	missense	possibly damaging	0.87
R0626:Ptprh	UTSW	7	4564272	missense	probably benign	0.00
R0741:Ptprh	UTSW	7	4554173	critical splice donor site	probably null
R1068:Ptprh	UTSW	7	4549463	missense	possibly damaging	0.89
R1226:Ptprh	UTSW	7	4603092	nonsense	probably null
R1487:Ptprh	UTSW	7	4552738	missense	probably damaging	1.00
R1495:Ptprh	UTSW	7	4580889	missense	probably benign	0.02
R1537:Ptprh	UTSW	7	4549699	missense	probably damaging	1.00
R1601:Ptprh	UTSW	7	4552638	missense	probably damaging	1.00
R1731:Ptprh	UTSW	7	4601913	missense	probably benign	0.00
R1920:Ptprh	UTSW	7	4549395	missense	probably benign	0.25
R2082:Ptprh	UTSW	7	4550775	missense	probably damaging	1.00
R2180:Ptprh	UTSW	7	4601868	missense	probably benign	0.26
R2214:Ptprh	UTSW	7	4552922	missense	possibly damaging	0.78
R2245:Ptprh	UTSW	7	4573346	missense	probably benign	0.09
R2271:Ptprh	UTSW	7	4603133	start gained	probably benign
R3693:Ptprh	UTSW	7	4554235	missense	probably damaging	0.99
R3713:Ptprh	UTSW	7	4571970	missense	probably damaging	1.00
R4081:Ptprh	UTSW	7	4580988	missense	probably damaging	0.99
R4205:Ptprh	UTSW	7	4597992	missense	probably damaging	1.00
R4689:Ptprh	UTSW	7	4597997	missense	possibly damaging	0.74
R4782:Ptprh	UTSW	7	4569577	missense	probably benign	0.08
R4838:Ptprh	UTSW	7	4573430	missense	possibly damaging	0.78
R4974:Ptprh	UTSW	7	4551007	splice site	probably null
R5430:Ptprh	UTSW	7	4551047	missense	probably damaging	1.00
R5533:Ptprh	UTSW	7	4549505	missense	probably damaging	1.00
R5544:Ptprh	UTSW	7	4580910	nonsense	probably null
R5547:Ptprh	UTSW	7	4554222	nonsense	probably null
R5869:Ptprh	UTSW	7	4601940	missense	probably benign	0.00
R5928:Ptprh	UTSW	7	4573508	missense	probably damaging	1.00
R6063:Ptprh	UTSW	7	4573362	missense	possibly damaging	0.80
R6112:Ptprh	UTSW	7	4597923	missense	probably benign	0.01
R6493:Ptprh	UTSW	7	4580990	missense	possibly damaging	0.65
R6733:Ptprh	UTSW	7	4603044	splice site	probably null
R6836:Ptprh	UTSW	7	4551135	missense	probably damaging	1.00
R6859:Ptprh	UTSW	7	4549371	nonsense	probably null
R6868:Ptprh	UTSW	7	4601865	missense	probably benign
R7015:Ptprh	UTSW	7	4552627	critical splice donor site	probably null
R7092:Ptprh	UTSW	7	4580861	critical splice donor site	probably null
R7147:Ptprh	UTSW	7	4550782	missense	probably damaging	1.00
R7177:Ptprh	UTSW	7	4569481	missense	possibly damaging	0.77
R7358:Ptprh	UTSW	7	4551007	splice site	probably null
R7436:Ptprh	UTSW	7	4552743	missense	probably damaging	1.00
R7512:Ptprh	UTSW	7	4571781	missense	possibly damaging	0.60
RF022:Ptprh	UTSW	7	4549368	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGAACTGATTAAGATCGAGAAAGA -3'
(R):5'- GGGCCTCACCTACTGGACC -3'

Sequencing Primer
(F):5'- TCAGTGTGAACAGCTCTGAC -3'
(R):5'- CTGGACCCAGTGCAGTAGACATG -3'

Posted On

2016-07-22