Incidental Mutation 'R0417:Nbeal1'
ID 40360
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 038619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0417 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 60180599-60338328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60247734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 905 (V905A)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834]
AlphaFold E9PYP2
Predicted Effect probably benign
Transcript: ENSMUST00000035569
AA Change: V905A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: V905A

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
Pfam:DUF4704 851 1130 3.4e-39 PFAM
low complexity region 1383 1401 N/A INTRINSIC
Pfam:DUF4800 1575 1828 6.3e-126 PFAM
coiled coil region 1859 1882 N/A INTRINSIC
Pfam:PH_BEACH 1889 1975 2e-24 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V905A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V905A

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188450
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 (GRCm38) L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 (GRCm38) K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 (GRCm38) Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 (GRCm38) probably benign Het
Acot2 T C 12: 83,990,613 (GRCm38) Y234H probably benign Het
Alox12e C T 11: 70,321,865 (GRCm38) V53I probably benign Het
Ankrd50 T C 3: 38,456,361 (GRCm38) H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 (GRCm38) L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 (GRCm38) S82G possibly damaging Het
Bicra C A 7: 15,972,322 (GRCm38) R1398L probably damaging Het
Boc T C 16: 44,520,234 (GRCm38) T118A probably benign Het
Btnl9 A G 11: 49,175,595 (GRCm38) Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 (GRCm38) E20A probably benign Het
Csrnp3 A G 2: 66,019,543 (GRCm38) Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 (GRCm38) I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 (GRCm38) T295S probably damaging Het
Dbn1 C T 13: 55,474,916 (GRCm38) E585K probably damaging Het
Dok1 A T 6: 83,031,569 (GRCm38) D377E probably damaging Het
Eed A T 7: 89,971,552 (GRCm38) Y87* probably null Het
Entpd3 T C 9: 120,557,421 (GRCm38) V156A probably damaging Het
Exo5 T A 4: 120,922,072 (GRCm38) T199S probably damaging Het
Extl2 T C 3: 116,024,357 (GRCm38) I106T probably benign Het
Ezh2 A G 6: 47,551,726 (GRCm38) C291R probably benign Het
Flvcr1 A T 1: 191,011,219 (GRCm38) M466K probably benign Het
Fras1 G T 5: 96,691,372 (GRCm38) M1583I probably benign Het
Fzd9 G T 5: 135,249,619 (GRCm38) R471S probably damaging Het
Galr1 A T 18: 82,405,540 (GRCm38) F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 (GRCm38) S354T probably benign Het
Gna11 A T 10: 81,530,904 (GRCm38) I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 (GRCm38) E430G possibly damaging Het
Hhatl C T 9: 121,788,762 (GRCm38) A254T probably benign Het
Ikzf1 A C 11: 11,769,352 (GRCm38) N353T probably benign Het
Il7 T A 3: 7,576,027 (GRCm38) T110S probably damaging Het
Keg1 A G 19: 12,711,060 (GRCm38) N53D probably damaging Het
Klhl21 T C 4: 152,015,507 (GRCm38) I558T probably damaging Het
Lca5l G A 16: 96,162,653 (GRCm38) T357M probably damaging Het
Lrba T C 3: 86,715,654 (GRCm38) S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 (GRCm38) Y709* probably null Het
Megf6 A G 4: 154,267,967 (GRCm38) E1261G probably benign Het
Mettl3 C T 14: 52,296,698 (GRCm38) G473D probably damaging Het
Mga A G 2: 119,902,790 (GRCm38) I40V probably damaging Het
Mmp13 T A 9: 7,276,602 (GRCm38) D232E probably benign Het
Nampt T C 12: 32,833,101 (GRCm38) V95A probably benign Het
Nomo1 A T 7: 46,068,698 (GRCm38) E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 (GRCm38) I101F probably damaging Het
Nup160 A T 2: 90,735,427 (GRCm38) I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 (GRCm38) S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 (GRCm38) Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 (GRCm38) V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 (GRCm38) S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 (GRCm38) I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 (GRCm38) F149S probably benign Het
Olfr870 G A 9: 20,171,214 (GRCm38) A119V probably damaging Het
Olfr894 A G 9: 38,219,455 (GRCm38) I211V probably benign Het
Osbpl3 C T 6: 50,348,018 (GRCm38) V167I probably benign Het
Pclo T A 5: 14,713,022 (GRCm38) H3836Q unknown Het
Prkcg A T 7: 3,304,304 (GRCm38) probably null Het
Ror1 A T 4: 100,412,000 (GRCm38) H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 (GRCm38) probably null Het
Slc40a1 G A 1: 45,911,374 (GRCm38) P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 (GRCm38) T239K probably benign Het
Snapc3 A G 4: 83,450,162 (GRCm38) I299V probably benign Het
Sp3 G A 2: 72,971,501 (GRCm38) A56V possibly damaging Het
Spag17 T A 3: 100,065,554 (GRCm38) S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 (GRCm38) T978A probably benign Het
Stom C A 2: 35,321,632 (GRCm38) V126F probably damaging Het
Stpg2 A G 3: 139,218,321 (GRCm38) T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 (GRCm38) T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 (GRCm38) I69S probably benign Het
Tbata A T 10: 61,180,339 (GRCm38) D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 (GRCm38) I638V probably benign Het
Tomm70a A G 16: 57,149,903 (GRCm38) D548G probably benign Het
Ust A G 10: 8,245,936 (GRCm38) F303L probably damaging Het
Vps13d A G 4: 144,976,560 (GRCm38) S4306P probably benign Het
Zfp691 A G 4: 119,170,496 (GRCm38) S180P possibly damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60,235,191 (GRCm38) nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60,281,883 (GRCm38) missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60,328,103 (GRCm38) missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60,217,225 (GRCm38) missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60,181,741 (GRCm38) missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60,195,011 (GRCm38) critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60,195,143 (GRCm38) missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60,235,353 (GRCm38) missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60,281,341 (GRCm38) missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60,242,625 (GRCm38) critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60,230,628 (GRCm38) missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60,242,625 (GRCm38) critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60,217,255 (GRCm38) missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60,242,535 (GRCm38) critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60,272,259 (GRCm38) critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60,253,501 (GRCm38) missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60,329,335 (GRCm38) missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60,235,237 (GRCm38) missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60,283,987 (GRCm38) missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60,287,444 (GRCm38) splice site probably benign
IGL02945:Nbeal1 APN 1 60,206,410 (GRCm38) missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60,253,413 (GRCm38) missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60,278,727 (GRCm38) missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60,236,459 (GRCm38) missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60,234,868 (GRCm38) missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60,234,869 (GRCm38) missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60,261,586 (GRCm38) critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60,242,567 (GRCm38) nonsense probably null
coach UTSW 1 60,253,481 (GRCm38) nonsense probably null
Committee UTSW 1 60,292,903 (GRCm38) missense probably damaging 1.00
Disgrace UTSW 1 60,281,310 (GRCm38) nonsense probably null
Dravrah UTSW 1 60,284,092 (GRCm38) missense probably damaging 1.00
Harvard UTSW 1 60,235,563 (GRCm38) splice site probably null
horrified UTSW 1 60,244,824 (GRCm38) missense probably damaging 1.00
Lampoon UTSW 1 60,261,586 (GRCm38) critical splice donor site probably null
lawyer UTSW 1 60,310,224 (GRCm38) nonsense probably null
magistrate UTSW 1 60,194,597 (GRCm38) critical splice donor site probably null
Maratimus UTSW 1 60,291,888 (GRCm38) missense probably damaging 1.00
National UTSW 1 60,222,263 (GRCm38) missense possibly damaging 0.95
phainopepla UTSW 1 60,319,687 (GRCm38) missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60,194,599 (GRCm38) splice site probably benign
satirical UTSW 1 60,235,562 (GRCm38) critical splice donor site probably null
silky UTSW 1 60,330,878 (GRCm38) splice site probably benign
stiggs UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60,264,272 (GRCm38) splice site probably benign
P0007:Nbeal1 UTSW 1 60,319,688 (GRCm38) missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60,291,937 (GRCm38) missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60,281,871 (GRCm38) missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60,310,263 (GRCm38) missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60,228,612 (GRCm38) splice site probably benign
R0054:Nbeal1 UTSW 1 60,287,401 (GRCm38) utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60,247,717 (GRCm38) missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60,247,717 (GRCm38) missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60,305,309 (GRCm38) missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60,305,370 (GRCm38) splice site probably benign
R0324:Nbeal1 UTSW 1 60,292,873 (GRCm38) missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60,268,063 (GRCm38) missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60,268,063 (GRCm38) missense probably damaging 1.00
R0421:Nbeal1 UTSW 1 60,268,439 (GRCm38) missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60,281,832 (GRCm38) nonsense probably null
R1034:Nbeal1 UTSW 1 60,290,006 (GRCm38) nonsense probably null
R1082:Nbeal1 UTSW 1 60,312,226 (GRCm38) missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60,260,269 (GRCm38) missense probably benign
R1187:Nbeal1 UTSW 1 60,194,528 (GRCm38) missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60,200,939 (GRCm38) missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60,305,291 (GRCm38) missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60,200,119 (GRCm38) missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60,260,334 (GRCm38) missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60,284,092 (GRCm38) missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60,267,941 (GRCm38) nonsense probably null
R1952:Nbeal1 UTSW 1 60,234,840 (GRCm38) missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60,234,840 (GRCm38) missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60,206,344 (GRCm38) missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60,319,687 (GRCm38) missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60,292,964 (GRCm38) splice site probably null
R2055:Nbeal1 UTSW 1 60,311,057 (GRCm38) missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60,270,356 (GRCm38) missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60,305,271 (GRCm38) splice site probably null
R2181:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60,281,895 (GRCm38) missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60,284,006 (GRCm38) missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60,330,878 (GRCm38) splice site probably benign
R2268:Nbeal1 UTSW 1 60,330,878 (GRCm38) splice site probably benign
R2351:Nbeal1 UTSW 1 60,237,098 (GRCm38) missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60,251,352 (GRCm38) missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60,251,370 (GRCm38) missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60,278,780 (GRCm38) missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60,251,413 (GRCm38) splice site probably benign
R3747:Nbeal1 UTSW 1 60,195,023 (GRCm38) missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60,194,599 (GRCm38) splice site probably benign
R4119:Nbeal1 UTSW 1 60,291,870 (GRCm38) missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60,330,948 (GRCm38) missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60,289,946 (GRCm38) missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60,267,774 (GRCm38) missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60,281,310 (GRCm38) nonsense probably null
R4618:Nbeal1 UTSW 1 60,228,731 (GRCm38) intron probably benign
R4673:Nbeal1 UTSW 1 60,329,390 (GRCm38) missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60,235,563 (GRCm38) splice site probably null
R4798:Nbeal1 UTSW 1 60,222,193 (GRCm38) splice site probably null
R4826:Nbeal1 UTSW 1 60,251,342 (GRCm38) missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60,253,375 (GRCm38) missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60,253,375 (GRCm38) missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60,292,903 (GRCm38) missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60,238,654 (GRCm38) missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60,237,179 (GRCm38) missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60,270,328 (GRCm38) missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60,235,559 (GRCm38) nonsense probably null
R5345:Nbeal1 UTSW 1 60,328,210 (GRCm38) critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60,310,999 (GRCm38) missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60,277,194 (GRCm38) missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60,237,152 (GRCm38) missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60,242,602 (GRCm38) missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60,291,847 (GRCm38) missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60,272,221 (GRCm38) missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60,228,791 (GRCm38) intron probably benign
R5918:Nbeal1 UTSW 1 60,267,892 (GRCm38) missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60,248,395 (GRCm38) missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60,248,405 (GRCm38) missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60,181,556 (GRCm38) start gained probably benign
R6113:Nbeal1 UTSW 1 60,222,263 (GRCm38) missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60,251,307 (GRCm38) missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60,257,484 (GRCm38) missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60,222,128 (GRCm38) missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60,295,924 (GRCm38) missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60,248,365 (GRCm38) missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60,238,719 (GRCm38) missense probably benign
R6457:Nbeal1 UTSW 1 60,253,474 (GRCm38) missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60,330,942 (GRCm38) missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60,281,310 (GRCm38) nonsense probably null
R7021:Nbeal1 UTSW 1 60,261,586 (GRCm38) critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60,310,947 (GRCm38) missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60,260,634 (GRCm38) nonsense probably null
R7157:Nbeal1 UTSW 1 60,237,158 (GRCm38) missense probably damaging 1.00
R7209:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60,200,951 (GRCm38) missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60,310,224 (GRCm38) nonsense probably null
R7312:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60,217,196 (GRCm38) missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60,244,810 (GRCm38) missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60,194,597 (GRCm38) critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60,261,584 (GRCm38) missense probably benign
R7507:Nbeal1 UTSW 1 60,235,467 (GRCm38) missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60,277,227 (GRCm38) missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60,244,824 (GRCm38) missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60,257,450 (GRCm38) missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60,319,341 (GRCm38) missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60,291,889 (GRCm38) missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60,260,432 (GRCm38) missense probably benign
R7902:Nbeal1 UTSW 1 60,291,870 (GRCm38) missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60,260,272 (GRCm38) nonsense probably null
R8053:Nbeal1 UTSW 1 60,279,795 (GRCm38) missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60,200,133 (GRCm38) missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60,237,151 (GRCm38) missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60,253,481 (GRCm38) nonsense probably null
R8209:Nbeal1 UTSW 1 60,277,177 (GRCm38) missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60,277,177 (GRCm38) missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60,235,562 (GRCm38) critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60,235,157 (GRCm38) missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60,268,383 (GRCm38) missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60,235,211 (GRCm38) missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60,261,584 (GRCm38) missense probably benign
R8952:Nbeal1 UTSW 1 60,260,300 (GRCm38) missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60,289,959 (GRCm38) missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60,278,726 (GRCm38) missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60,268,389 (GRCm38) missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60,247,745 (GRCm38) nonsense probably null
R9168:Nbeal1 UTSW 1 60,291,888 (GRCm38) missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60,281,266 (GRCm38) missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60,278,680 (GRCm38) missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60,268,389 (GRCm38) missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60,258,659 (GRCm38) missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60,310,265 (GRCm38) missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60,251,128 (GRCm38) nonsense probably null
R9557:Nbeal1 UTSW 1 60,235,350 (GRCm38) missense probably benign
R9560:Nbeal1 UTSW 1 60,329,385 (GRCm38) missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60,311,088 (GRCm38) missense probably damaging 1.00
R9784:Nbeal1 UTSW 1 60,260,582 (GRCm38) nonsense probably null
X0022:Nbeal1 UTSW 1 60,277,232 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGACAATGACCCAAAATGGTCTCTT -3'
(R):5'- CTAAGTCAGGTCAGTAGGGAAGCTACA -3'

Sequencing Primer
(F):5'- CTGTCTGTGTAAGGATACATTCAGC -3'
(R):5'- TCAGTAGGGAAGCTACAACAGC -3'
Posted On 2013-05-23