Incidental Mutation 'R5218:Phrf1'
ID403603
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene NamePHD and ring finger domains 1
Synonyms
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141228784-141262750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141261301 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1353 (N1353S)
Ref Sequence ENSEMBL: ENSMUSP00000113195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000132540] [ENSMUST00000155123] [ENSMUST00000209899]
Predicted Effect probably benign
Transcript: ENSMUST00000026571
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097952
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106023
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106027
AA Change: N1512S

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: N1512S

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122143
AA Change: N1353S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: N1353S

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122868
Predicted Effect probably benign
Transcript: ENSMUST00000123525
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect unknown
Transcript: ENSMUST00000130687
AA Change: N160S
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611
AA Change: N160S

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect probably benign
Transcript: ENSMUST00000132540
Predicted Effect unknown
Transcript: ENSMUST00000142572
AA Change: N602S
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611
AA Change: N602S

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156938
Predicted Effect probably benign
Transcript: ENSMUST00000209899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 141258877 unclassified probably benign
IGL01391:Phrf1 APN 7 141262481 missense probably damaging 1.00
IGL01472:Phrf1 APN 7 141256490 splice site probably benign
IGL01633:Phrf1 APN 7 141260500 missense probably benign 0.43
IGL01808:Phrf1 APN 7 141260966 missense probably damaging 1.00
IGL02004:Phrf1 APN 7 141260333 missense probably benign 0.39
IGL02138:Phrf1 APN 7 141259283 unclassified probably benign
IGL02678:Phrf1 APN 7 141260282 missense probably damaging 1.00
IGL03077:Phrf1 APN 7 141254968 nonsense probably null
PIT4466001:Phrf1 UTSW 7 141258812 missense unknown
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0040:Phrf1 UTSW 7 141243857 missense probably damaging 1.00
R0358:Phrf1 UTSW 7 141258304 unclassified probably benign
R0445:Phrf1 UTSW 7 141247331 utr 3 prime probably benign
R0535:Phrf1 UTSW 7 141260065 missense probably benign 0.07
R0561:Phrf1 UTSW 7 141254963 missense probably benign 0.00
R0940:Phrf1 UTSW 7 141254855 splice site probably benign
R1499:Phrf1 UTSW 7 141256651 missense probably damaging 1.00
R1511:Phrf1 UTSW 7 141259801 unclassified probably benign
R1651:Phrf1 UTSW 7 141237521 missense probably benign
R1691:Phrf1 UTSW 7 141261874 nonsense probably null
R1778:Phrf1 UTSW 7 141232456 missense probably benign 0.01
R1851:Phrf1 UTSW 7 141240918 missense probably damaging 1.00
R2239:Phrf1 UTSW 7 141237692 missense probably damaging 1.00
R2857:Phrf1 UTSW 7 141259680 unclassified probably benign
R3796:Phrf1 UTSW 7 141259918 nonsense probably null
R3797:Phrf1 UTSW 7 141259918 nonsense probably null
R3798:Phrf1 UTSW 7 141259918 nonsense probably null
R3799:Phrf1 UTSW 7 141259918 nonsense probably null
R4080:Phrf1 UTSW 7 141259720 unclassified probably benign
R4081:Phrf1 UTSW 7 141259057 unclassified probably benign
R4557:Phrf1 UTSW 7 141258929 unclassified probably benign
R5217:Phrf1 UTSW 7 141260703 missense probably damaging 1.00
R5276:Phrf1 UTSW 7 141259283 unclassified probably benign
R5442:Phrf1 UTSW 7 141240937 missense probably damaging 1.00
R5501:Phrf1 UTSW 7 141259921 missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 141258465 unclassified probably benign
R5837:Phrf1 UTSW 7 141260061 missense probably benign 0.34
R5907:Phrf1 UTSW 7 141260540 missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 141259102 unclassified probably benign
R6024:Phrf1 UTSW 7 141258985 unclassified probably benign
R6244:Phrf1 UTSW 7 141237673 missense probably damaging 1.00
R6512:Phrf1 UTSW 7 141260396 missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 141237563 missense probably damaging 0.98
R7311:Phrf1 UTSW 7 141240933 missense unknown
R7409:Phrf1 UTSW 7 141259292 missense unknown
R7517:Phrf1 UTSW 7 141256610 missense unknown
R7560:Phrf1 UTSW 7 141231225 critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 141254929 missense unknown
R7700:Phrf1 UTSW 7 141254929 missense unknown
X0027:Phrf1 UTSW 7 141256568 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAGATCCCTCTCAGGTG -3'
(R):5'- GGGAGTAGCAGTCCTTTCTTC -3'

Sequencing Primer
(F):5'- ATCCCTCTCAGGTGGGTGC -3'
(R):5'- AGCAGTCCTTTCTTCTGAGTTG -3'
Posted On2016-07-22