Incidental Mutation 'R5218:Scara5'
ID403618
Institutional Source Beutler Lab
Gene Symbol Scara5
Ensembl Gene ENSMUSG00000022032
Gene Namescavenger receptor class A, member 5
Synonyms4932433F15Rik, 4933425F03Rik
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5218 (G1)
Quality Score217
Status Validated
Chromosome14
Chromosomal Location65666403-65764826 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CG to C at 65759662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022610]
Predicted Effect probably null
Transcript: ENSMUST00000022610
SMART Domains Protein: ENSMUSP00000022610
Gene: ENSMUSG00000022032

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 357 1.8e-8 PFAM
Pfam:Collagen 327 383 1.1e-8 PFAM
SR 389 489 5.5e-56 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in decreased male fertility and lymphocytic infiltration of the stroma of various tissues, particularly in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Scara5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Scara5 APN 14 65738415 splice site probably benign
IGL00772:Scara5 APN 14 65670562 utr 5 prime probably benign
IGL01768:Scara5 APN 14 65689775 nonsense probably null
IGL02081:Scara5 APN 14 65730655 missense possibly damaging 0.96
IGL02280:Scara5 APN 14 65730778 missense probably benign
IGL02795:Scara5 APN 14 65730680 missense possibly damaging 0.72
IGL02887:Scara5 APN 14 65762829 missense unknown
R0040:Scara5 UTSW 14 65762717 splice site probably benign
R0605:Scara5 UTSW 14 65759648 missense possibly damaging 0.85
R0735:Scara5 UTSW 14 65731019 missense possibly damaging 0.85
R0925:Scara5 UTSW 14 65762718 critical splice acceptor site probably benign
R1575:Scara5 UTSW 14 65730865 missense probably benign 0.18
R1746:Scara5 UTSW 14 65731090 missense probably benign
R1968:Scara5 UTSW 14 65689800 missense possibly damaging 0.73
R4455:Scara5 UTSW 14 65762747 missense probably benign 0.01
R4547:Scara5 UTSW 14 65670574 missense possibly damaging 0.72
R4779:Scara5 UTSW 14 65730749 missense probably benign 0.03
R5316:Scara5 UTSW 14 65689815 missense possibly damaging 0.73
R5331:Scara5 UTSW 14 65759662 frame shift probably null
R5332:Scara5 UTSW 14 65759662 frame shift probably null
R5366:Scara5 UTSW 14 65759662 frame shift probably null
R5367:Scara5 UTSW 14 65759662 frame shift probably null
R5368:Scara5 UTSW 14 65759662 frame shift probably null
R5369:Scara5 UTSW 14 65759662 frame shift probably null
R5417:Scara5 UTSW 14 65759662 frame shift probably null
R5418:Scara5 UTSW 14 65759662 frame shift probably null
R5420:Scara5 UTSW 14 65759662 frame shift probably null
R5447:Scara5 UTSW 14 65759662 frame shift probably null
R5473:Scara5 UTSW 14 65740339 missense possibly damaging 0.84
R5580:Scara5 UTSW 14 65731079 missense probably benign 0.02
R7734:Scara5 UTSW 14 65731151 missense possibly damaging 0.85
R7995:Scara5 UTSW 14 65759608 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GACACAAGGTAGCCTCATGG -3'
(R):5'- TCACATGAAGGTGACGCAG -3'

Sequencing Primer
(F):5'- CACAAGGTAGCCTCATGGTTTTAGC -3'
(R):5'- CACATGAAGGTGACGCAGACTTTG -3'
Posted On2016-07-22