Incidental Mutation 'R5218:Dip2b'
ID 403624
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042791-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R5218 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100052177 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 259 (D259E)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: D259E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D259E

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,629,628 (GRCm39) N230K possibly damaging Het
4933428M09Rik G T X: 138,080,282 (GRCm39) G16* probably null Het
Albfm1 A G 5: 90,729,777 (GRCm39) K400R probably benign Het
Amigo1 A G 3: 108,095,086 (GRCm39) probably null Het
Arhgap30 A T 1: 171,236,328 (GRCm39) T901S probably benign Het
Arpp21 T C 9: 111,972,499 (GRCm39) D264G probably damaging Het
Ccbe1 C T 18: 66,216,229 (GRCm39) G165S probably damaging Het
Celsr1 T C 15: 85,816,585 (GRCm39) D1786G probably damaging Het
Cntn1 T C 15: 92,237,430 (GRCm39) L1008P unknown Het
Dclk2 T A 3: 86,712,985 (GRCm39) D489V probably damaging Het
Disp3 T C 4: 148,327,333 (GRCm39) S1184G possibly damaging Het
Dync1li2 C T 8: 105,169,179 (GRCm39) W36* probably null Het
Ece2 A T 16: 20,437,290 (GRCm39) M211L probably benign Het
Edn3 C T 2: 174,603,345 (GRCm39) A31V probably benign Het
Enpp2 T C 15: 54,750,982 (GRCm39) Q266R possibly damaging Het
Fabp1 C A 6: 71,176,944 (GRCm39) Q12K probably damaging Het
Flt1 G A 5: 147,618,738 (GRCm39) T199M probably damaging Het
Galns T A 8: 123,325,328 (GRCm39) I275F probably damaging Het
Gapvd1 T C 2: 34,618,488 (GRCm39) D295G probably benign Het
Gatb A G 3: 85,511,751 (GRCm39) I169V probably benign Het
Gpd1 T A 15: 99,618,011 (GRCm39) I109N probably damaging Het
Gps2 T C 11: 69,807,121 (GRCm39) probably null Het
Hsd17b12 T C 2: 93,913,608 (GRCm39) N99D probably benign Het
Itga3 A T 11: 94,953,574 (GRCm39) V256E probably benign Het
Kcnma1 T A 14: 23,513,253 (GRCm39) Y527F probably damaging Het
Lamc1 C A 1: 153,103,442 (GRCm39) V1375L probably damaging Het
Lrp1 C A 10: 127,384,488 (GRCm39) E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,026,736 (GRCm39) probably benign Het
Medag A T 5: 149,345,719 (GRCm39) probably benign Het
Ncdn C A 4: 126,644,603 (GRCm39) R73L probably benign Het
Nr4a1 T C 15: 101,170,034 (GRCm39) V339A probably benign Het
Ocln G T 13: 100,642,822 (GRCm39) P420Q probably damaging Het
Or5ac24 A T 16: 59,165,270 (GRCm39) S265T probably benign Het
Pank4 C T 4: 155,064,185 (GRCm39) T681I probably benign Het
Pcdhb6 T A 18: 37,467,388 (GRCm39) V103E possibly damaging Het
Pcsk6 T C 7: 65,675,036 (GRCm39) F469S probably benign Het
Phrf1 A G 7: 140,841,214 (GRCm39) N1353S possibly damaging Het
Pou6f2 A G 13: 18,326,586 (GRCm39) I72T probably damaging Het
Ppig T C 2: 69,563,127 (GRCm39) probably benign Het
Ptprh T C 7: 4,600,919 (GRCm39) S153G probably benign Het
Rab11b T C 17: 33,967,924 (GRCm39) N91S probably benign Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Slc2a9 A G 5: 38,610,524 (GRCm39) S92P probably damaging Het
Slit3 G A 11: 35,575,002 (GRCm39) probably null Het
Sox5 T C 6: 143,906,616 (GRCm39) I280V possibly damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Tdrd9 C T 12: 112,029,909 (GRCm39) probably benign Het
Tmem273 T A 14: 32,538,793 (GRCm39) probably null Het
Tmem74 A T 15: 43,730,640 (GRCm39) N134K possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Txnl1 T G 18: 63,812,538 (GRCm39) K85N probably benign Het
Vmn2r77 T A 7: 86,451,341 (GRCm39) M409K probably damaging Het
Wipf1 T C 2: 73,274,812 (GRCm39) D53G probably damaging Het
Wnt10a G A 1: 74,832,754 (GRCm39) V116I probably benign Het
Xpot T A 10: 121,455,043 (GRCm39) D33V probably damaging Het
Znrf3 C T 11: 5,231,519 (GRCm39) V665M possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTTCCCTTTACTGTCAGTAC -3'
(R):5'- TTCCACAGTCAGTTCACAGC -3'

Sequencing Primer
(F):5'- CTGTCAGTACCGTATGATTTTAACTC -3'
(R):5'- CCTTCTGTGAAAGCCAACCATG -3'
Posted On 2016-07-22