Incidental Mutation 'R5218:Rab11b'
ID403627
Institutional Source Beutler Lab
Gene Symbol Rab11b
Ensembl Gene ENSMUSG00000077450
Gene NameRAB11B, member RAS oncogene family
SynonymsA730055L17Rik
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5218 (G1)
Quality Score208
Status Validated
Chromosome17
Chromosomal Location33742484-33760530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33748950 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 91 (N91S)
Ref Sequence ENSEMBL: ENSMUSP00000134448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057373] [ENSMUST00000173860] [ENSMUST00000173987]
Predicted Effect probably benign
Transcript: ENSMUST00000057373
AA Change: N116S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110021
Gene: ENSMUSG00000077450
AA Change: N116S

DomainStartEndE-ValueType
RAB 12 175 3.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172894
AA Change: N58S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134544
Gene: ENSMUSG00000077450
AA Change: N58S

DomainStartEndE-ValueType
RAB 2 118 3.53e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173860
AA Change: N91S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134448
Gene: ENSMUSG00000077450
AA Change: N91S

DomainStartEndE-ValueType
RAB 12 150 3.17e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173987
AA Change: N116S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133921
Gene: ENSMUSG00000077450
AA Change: N116S

DomainStartEndE-ValueType
RAB 12 149 2.81e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174744
Meta Mutation Damage Score 0.2132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Ccbe1 C T 18: 66,083,158 G165S probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Rab11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Rab11b APN 17 33749816 missense probably damaging 1.00
R1969:Rab11b UTSW 17 33760235 missense probably damaging 1.00
R2096:Rab11b UTSW 17 33749002 missense probably damaging 1.00
R2566:Rab11b UTSW 17 33747718 missense probably benign 0.01
R3706:Rab11b UTSW 17 33747766 missense probably benign
R4093:Rab11b UTSW 17 33749789 missense possibly damaging 0.94
R5070:Rab11b UTSW 17 33748881 missense probably damaging 1.00
R5306:Rab11b UTSW 17 33760269 utr 5 prime probably benign
R7205:Rab11b UTSW 17 33749867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCCTTGACACTGGAGG -3'
(R):5'- TCAAAGATAGGACGACTGCCCC -3'

Sequencing Primer
(F):5'- CCTTGACACTGGAGGAGGTG -3'
(R):5'- CCATCCTGTAGGGTTTCCATGAG -3'
Posted On2016-07-22