Incidental Mutation 'R5218:Ccbe1'
ID403631
Institutional Source Beutler Lab
Gene Symbol Ccbe1
Ensembl Gene ENSMUSG00000046318
Gene Namecollagen and calcium binding EGF domains 1
Synonyms
MMRRC Submission 042791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5218 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location66045302-66302739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66083158 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 165 (G165S)
Ref Sequence ENSEMBL: ENSMUSP00000117636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061103] [ENSMUST00000130300]
Predicted Effect probably damaging
Transcript: ENSMUST00000061103
AA Change: G165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052011
Gene: ENSMUSG00000046318
AA Change: G165S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.7e-9 PFAM
Pfam:Collagen 299 337 1.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130300
AA Change: G165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117636
Gene: ENSMUSG00000046318
AA Change: G165S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 93 134 7.95e0 SMART
EGF_CA 135 176 1.69e-12 SMART
Pfam:Collagen 246 295 7.4e-9 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146610
Meta Mutation Damage Score 0.9126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to function in extracellular matrix remodeling and migration. It is predominantly expressed in the ovary, but down regulated in ovarian cancer cell lines and primary carcinomas, suggesting its role as a tumour suppressor. Mutations in this gene have been associated with Hennekam lymphangiectasia-lymphedema syndrome, a generalized lymphatic dysplasia in humans. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with edema and absence of lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T A 14: 32,816,836 probably null Het
4921524L21Rik T A 18: 6,629,628 N230K possibly damaging Het
4933428M09Rik G T X: 139,179,533 G16* probably null Het
5830473C10Rik A G 5: 90,581,918 K400R probably benign Het
Amigo1 A G 3: 108,187,770 probably null Het
Arhgap30 A T 1: 171,408,760 T901S probably benign Het
Arpp21 T C 9: 112,143,431 D264G probably damaging Het
Celsr1 T C 15: 85,932,384 D1786G probably damaging Het
Cntn1 T C 15: 92,339,549 L1008P unknown Het
Dclk2 T A 3: 86,805,678 D489V probably damaging Het
Dip2b T A 15: 100,154,296 D259E probably benign Het
Disp3 T C 4: 148,242,876 S1184G possibly damaging Het
Dync1li2 C T 8: 104,442,547 W36* probably null Het
Ece2 A T 16: 20,618,540 M211L probably benign Het
Edn3 C T 2: 174,761,552 A31V probably benign Het
Enpp2 T C 15: 54,887,586 Q266R possibly damaging Het
Fabp1 C A 6: 71,199,960 Q12K probably damaging Het
Flt1 G A 5: 147,681,928 T199M probably damaging Het
Galns T A 8: 122,598,589 I275F probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gatb A G 3: 85,604,444 I169V probably benign Het
Gpd1 T A 15: 99,720,130 I109N probably damaging Het
Gps2 T C 11: 69,916,295 probably null Het
Hsd17b12 T C 2: 94,083,263 N99D probably benign Het
Itga3 A T 11: 95,062,748 V256E probably benign Het
Kcnma1 T A 14: 23,463,185 Y527F probably damaging Het
Lamc1 C A 1: 153,227,696 V1375L probably damaging Het
Lrp1 C A 10: 127,548,619 E3580D probably damaging Het
Ltbp4 AATTCAGGCCAAGGCTGGGATTCAGGCCGAGGCCGGGATTCAGGCCTAGGCTGGGATTCAGGC AATTCAGGCCTAGGCTGGGATTCAGGC 7: 27,327,311 probably benign Het
Medag A T 5: 149,422,254 probably benign Het
Ncdn C A 4: 126,750,810 R73L probably benign Het
Nr4a1 T C 15: 101,272,153 V339A probably benign Het
Ocln G T 13: 100,506,314 P420Q probably damaging Het
Olfr206 A T 16: 59,344,907 S265T probably benign Het
Pank4 C T 4: 154,979,728 T681I probably benign Het
Pcdhb6 T A 18: 37,334,335 V103E possibly damaging Het
Pcsk6 T C 7: 66,025,288 F469S probably benign Het
Phrf1 A G 7: 141,261,301 N1353S possibly damaging Het
Pou6f2 A G 13: 18,152,001 I72T probably damaging Het
Ppig T C 2: 69,732,783 probably benign Het
Ptprh T C 7: 4,597,920 S153G probably benign Het
Rab11b T C 17: 33,748,950 N91S probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Slc2a9 A G 5: 38,453,181 S92P probably damaging Het
Slit3 G A 11: 35,684,175 probably null Het
Sox5 T C 6: 143,960,890 I280V possibly damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Tdrd9 C T 12: 112,063,475 probably benign Het
Tmem74 A T 15: 43,867,244 N134K possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 T G 18: 63,679,467 K85N probably benign Het
Vmn2r77 T A 7: 86,802,133 M409K probably damaging Het
Wipf1 T C 2: 73,444,468 D53G probably damaging Het
Wnt10a G A 1: 74,793,595 V116I probably benign Het
Xpot T A 10: 121,619,138 D33V probably damaging Het
Znrf3 C T 11: 5,281,519 V665M possibly damaging Het
Other mutations in Ccbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ccbe1 APN 18 66066727 critical splice donor site probably null
R0032:Ccbe1 UTSW 18 66291652 missense possibly damaging 0.81
R0575:Ccbe1 UTSW 18 66093995 splice site probably benign
R0722:Ccbe1 UTSW 18 66084806 missense probably damaging 1.00
R3122:Ccbe1 UTSW 18 66066829 missense probably benign 0.02
R4642:Ccbe1 UTSW 18 66291583 intron probably benign
R5334:Ccbe1 UTSW 18 66083245 missense probably damaging 0.99
R5369:Ccbe1 UTSW 18 66061414 missense probably benign 0.00
R5806:Ccbe1 UTSW 18 66076355 nonsense probably null
R5865:Ccbe1 UTSW 18 66083151 missense possibly damaging 0.48
R6752:Ccbe1 UTSW 18 66076307 critical splice donor site probably null
R6763:Ccbe1 UTSW 18 66061388 missense possibly damaging 0.65
R7226:Ccbe1 UTSW 18 66083128 missense probably damaging 1.00
R7807:Ccbe1 UTSW 18 66066757 missense probably damaging 1.00
R7878:Ccbe1 UTSW 18 66076391 missense possibly damaging 0.94
R7961:Ccbe1 UTSW 18 66076391 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGGGCTCCCAAGTACTTATAATTTAC -3'
(R):5'- CCAGATCTAGAAGTTTCTCTTGTTC -3'

Sequencing Primer
(F):5'- CACACACAATTACACACACATATATG -3'
(R):5'- TGTTCATACCAATATAGAGGGACCAG -3'
Posted On2016-07-22