Incidental Mutation 'R5229:Tspan2'
ID403639
Institutional Source Beutler Lab
Gene Symbol Tspan2
Ensembl Gene ENSMUSG00000027858
Gene Nametetraspanin 2
SynonymsB230119D02Rik, 6330415F13Rik
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5229 (G1)
Quality Score191
Status Validated
Chromosome3
Chromosomal Location102734529-102801513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102768899 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 208 (M208T)
Ref Sequence ENSEMBL: ENSMUSP00000029451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029451] [ENSMUST00000119902] [ENSMUST00000196611] [ENSMUST00000197345]
Predicted Effect probably damaging
Transcript: ENSMUST00000029451
AA Change: M208T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029451
Gene: ENSMUSG00000027858
AA Change: M208T

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 214 6.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119902
AA Change: M204T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113803
Gene: ENSMUSG00000027858
AA Change: M204T

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Tetraspannin 19 210 2.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196611
AA Change: M140T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142964
Gene: ENSMUSG00000027858
AA Change: M140T

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 146 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197345
SMART Domains Protein: ENSMUSP00000142543
Gene: ENSMUSG00000027858

DomainStartEndE-ValueType
Pfam:Tetraspannin 3 87 1.5e-6 PFAM
Meta Mutation Damage Score 0.5469 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice are viable and fertile with mild astrogliosis and microgliosis in the absence of axonal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Tspan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Tspan2 APN 3 102758233 critical splice donor site probably null
IGL02341:Tspan2 APN 3 102765213 missense probably damaging 1.00
R0336:Tspan2 UTSW 3 102735027 missense probably null 0.00
R0399:Tspan2 UTSW 3 102759385 missense probably damaging 1.00
R1732:Tspan2 UTSW 3 102768877 missense probably damaging 1.00
R5118:Tspan2 UTSW 3 102749835 missense probably benign 0.17
R7085:Tspan2 UTSW 3 102760954 missense probably benign 0.01
R7431:Tspan2 UTSW 3 102749791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTCTTGCTTAGTTGCCATC -3'
(R):5'- CAGACATTCACTCAAGGGGC -3'

Sequencing Primer
(F):5'- GCTTAGTTGCCATCCTTAAGAAAC -3'
(R):5'- GAGTCAGACTTACATACATGTGC -3'
Posted On2016-07-22