Mutagenetix > Incidental Mutations

Incidental Mutation 'R5229:Cnga1'

403652

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

042802-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R5229 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72609500 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 199 (S199P)

Ref Sequence

ENSEMBL: ENSMUSP00000143881 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087213
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: S199P

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000169997
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: S199P

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000201463
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: S199P

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Meta Mutation Damage Score

0.8766

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	T	C	1: 16,080,959		probably benign	Het
4930562C15Rik	A	G	16: 4,850,051	I435M	possibly damaging	Het
8430408G22Rik	T	C	6: 116,652,031	S112P	possibly damaging	Het
Adcy5	A	G	16: 35,269,070	I546V	probably damaging	Het
Apob	A	G	12: 7,977,806	T10A	probably benign	Het
Brwd1	C	A	16: 96,002,209	D2254Y	possibly damaging	Het
Bub1b	C	A	2: 118,629,989	D600E	probably damaging	Het
C87499	T	C	4: 88,630,135	D11G	possibly damaging	Het
Cyp3a11	G	T	5: 145,855,135	L483I	probably benign	Het
Dpysl3	C	A	18: 43,332,951	G457V	probably damaging	Het
Eif4g3	C	A	4: 138,096,794	P36T	possibly damaging	Het
Epb41	C	A	4: 131,978,935	G415C	probably damaging	Het
Erap1	G	A	13: 74,660,375	V69M	possibly damaging	Het
F2	A	T	2: 91,630,241	Y301*	probably null	Het
F2rl2	A	T	13: 95,700,687	N80I	possibly damaging	Het
Gm15446	T	G	5: 109,943,170	H429Q	probably damaging	Het
Gm8773	A	T	5: 5,575,565	Y87F	possibly damaging	Het
Gpat3	G	A	5: 100,883,424	G148D	probably damaging	Het
Gpr26	A	T	7: 131,984,247	R315S	probably damaging	Het
Hdac9	A	C	12: 34,437,164	H100Q	probably damaging	Het
Heatr5a	A	T	12: 51,947,978	V457D	probably benign	Het
Igkv10-96	A	G	6: 68,632,239	M24T	possibly damaging	Het
Igkv2-95-2	A	G	6: 68,648,111		noncoding transcript	Het
Kdm4a	G	A	4: 118,146,605	S758F	probably damaging	Het
Lrg1	A	G	17: 56,120,154	W273R	probably damaging	Het
Man2a1	A	T	17: 64,710,734	Q658H	probably benign	Het
Mapkapk5	T	C	5: 121,533,391		probably null	Het
Mcm6	T	C	1: 128,333,584	D761G	possibly damaging	Het
Myh8	A	T	11: 67,284,484	Y286F	probably damaging	Het
Nbn	C	T	4: 15,963,893	T98I	probably damaging	Het
Nrd1	T	C	4: 109,049,108	S685P	probably damaging	Het
Nudcd3	A	G	11: 6,193,238	V80A	probably benign	Het
Olfr121	A	G	17: 37,752,301	H149R	probably benign	Het
Olfr474	A	G	7: 107,955,169	H176R	probably damaging	Het
Pdcd6ip	A	T	9: 113,678,333	M390K	probably damaging	Het
Pon1	C	T	6: 5,177,295	V205I	possibly damaging	Het
Ppp4r2	C	A	6: 100,865,215	H212Q	probably benign	Het
Prl2c5	G	A	13: 13,185,856	C33Y	probably damaging	Het
Rbak	A	G	5: 143,174,162	F379L	probably damaging	Het
Rcc2	G	A	4: 140,717,029	D344N	probably damaging	Het
Rgs3	T	C	4: 62,702,187	L550P	probably damaging	Het
Rnasek	A	T	11: 70,239,660	M25K	probably damaging	Het
Scgb1b24	A	T	7: 33,744,095	T60S	possibly damaging	Het
Scn5a	A	G	9: 119,535,976	F392S	probably damaging	Het
Scpep1	A	T	11: 88,937,045	V209E	probably damaging	Het
Slc35g1	A	G	19: 38,402,632		probably null	Het
Sorbs1	A	G	19: 40,340,707	I554T	probably damaging	Het
Spats1	A	G	17: 45,466,133		probably benign	Het
Tdp1	A	G	12: 99,893,660	Q202R	probably damaging	Het
Trav6-5	T	G	14: 53,491,588	S102A	probably damaging	Het
Tspan2	T	C	3: 102,768,899	M208T	probably damaging	Het
Ube4b	A	G	4: 149,387,178	S84P	probably damaging	Het
Vmn1r237	C	A	17: 21,314,371	Q119K	probably benign	Het
Vmn2r125	C	T	4: 156,351,038	T237I	probably benign	Het
Zfp65	A	T	13: 67,708,810	S117T	probably benign	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCCTGGATCAGCAGGAATG -3'
(R):5'- TCTTACAGACCTCGCTAACTTTAG -3'

Sequencing Primer
(F):5'- GCCAATGAGTAAGACCATGTTAC -3'
(R):5'- CCAAGTAGTCTCCATGTCT -3'

Posted On

2016-07-22