Incidental Mutation 'R5229:Cnga1'
ID403652
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Namecyclic nucleotide gated channel alpha 1
SynonymsCncg
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72603696-72644275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72609500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 199 (S199P)
Ref Sequence ENSEMBL: ENSMUSP00000143881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]
Predicted Effect probably damaging
Transcript: ENSMUST00000087213
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: S199P

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000169997
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: S199P

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000201463
AA Change: S199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: S199P

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Meta Mutation Damage Score 0.8766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4357:Cnga1 UTSW 5 72618252 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5754:Cnga1 UTSW 5 72605272 missense probably benign 0.00
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6391:Cnga1 UTSW 5 72612359 critical splice donor site probably null
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7299:Cnga1 UTSW 5 72605432 missense probably benign 0.20
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense probably benign 0.24
R7808:Cnga1 UTSW 5 72604273 missense possibly damaging 0.69
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGGATCAGCAGGAATG -3'
(R):5'- TCTTACAGACCTCGCTAACTTTAG -3'

Sequencing Primer
(F):5'- GCCAATGAGTAAGACCATGTTAC -3'
(R):5'- CCAAGTAGTCTCCATGTCT -3'
Posted On2016-07-22