Incidental Mutation 'R5229:Gpr26'
ID403664
Institutional Source Beutler Lab
Gene Symbol Gpr26
Ensembl Gene ENSMUSG00000040125
Gene NameG protein-coupled receptor 26
Synonyms
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131966460-131994405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131984247 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 315 (R315S)
Ref Sequence ENSEMBL: ENSMUSP00000041664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045840] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000045840
AA Change: R315S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041664
Gene: ENSMUSG00000040125
AA Change: R315S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 15 309 1.9e-7 PFAM
Pfam:7tm_1 22 294 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.5054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-couple receptor protein. G-protein-coupled receptors are a large family of membrane proteins that are involved in cellular responses to environmental stimuli, neurotransmitters, and hormones. The encoded protein may play a role in neurodegenerative diseases. Epigenetic silencing of this gene has been observed in gliomas. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit increased anxiety- and depression-related behaviors and alcohol preference. Female mice homozygous for another allele display increased susceptibility to diet-induced obesity with increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Gpr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Gpr26 APN 7 131967501 missense probably damaging 1.00
IGL01345:Gpr26 APN 7 131967432 missense possibly damaging 0.90
IGL01658:Gpr26 APN 7 131984105 missense probably benign
IGL02724:Gpr26 APN 7 131974392 critical splice donor site probably null
R0408:Gpr26 UTSW 7 131967520 missense possibly damaging 0.81
R0408:Gpr26 UTSW 7 131974272 splice site probably null
R0547:Gpr26 UTSW 7 131984297 missense probably benign 0.01
R2508:Gpr26 UTSW 7 131967094 missense probably damaging 0.98
R4088:Gpr26 UTSW 7 131967076 missense probably benign 0.00
R4630:Gpr26 UTSW 7 131966980 missense probably damaging 1.00
R4680:Gpr26 UTSW 7 131974353 missense probably benign 0.34
R4756:Gpr26 UTSW 7 131967501 missense probably damaging 1.00
R5610:Gpr26 UTSW 7 131966965 missense possibly damaging 0.94
R6605:Gpr26 UTSW 7 131984164 missense possibly damaging 0.91
R6653:Gpr26 UTSW 7 131984101 missense probably benign 0.00
R7213:Gpr26 UTSW 7 131967490 missense probably damaging 1.00
R7351:Gpr26 UTSW 7 131974365 missense probably damaging 1.00
Z1088:Gpr26 UTSW 7 131984094 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCTGGTGGAACTCTTC -3'
(R):5'- TGACATCTACCCTGGAAGAGC -3'

Sequencing Primer
(F):5'- GGTGGAACTCTTCTCCACAG -3'
(R):5'- TGTTCAGACGTCAGCATCACG -3'
Posted On2016-07-22