Incidental Mutation 'R5229:Hdac9'
ID403672
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34437164 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 100 (H100Q)
Ref Sequence ENSEMBL: ENSMUSP00000148224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209463] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably damaging
Transcript: ENSMUST00000110819
AA Change: H79Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: H79Q

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209463
AA Change: H79Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000209667
AA Change: H79Q

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: H79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: H79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: H79Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210724
AA Change: H79Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211107
AA Change: H48Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211632
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: H100Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34433210 missense probably benign 0.31
R7974:Hdac9 UTSW 12 34303220 missense possibly damaging 0.87
R7990:Hdac9 UTSW 12 34215453 missense probably benign 0.05
R8489:Hdac9 UTSW 12 34437181 missense probably damaging 1.00
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTACTTACCCAAGTCTCCAAC -3'
(R):5'- ATCAGAGGTTCCTATGGGCC -3'

Sequencing Primer
(F):5'- TTACCCAAGTCTCCAACTAGTAC -3'
(R):5'- GGAGCCCATCTCACCTTTAGAC -3'
Posted On2016-07-22