Incidental Mutation 'R5229:Heatr5a'
ID403673
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51947978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 457 (V457D)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: V457D

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: V457D

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219277
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 synonymous probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGTCACTGAACCGAGCAAG -3'
(R):5'- GAAGCGATCTCTACGTTGAAAACC -3'

Sequencing Primer
(F):5'- GGCCGCCACAGCAGAAC -3'
(R):5'- GATCTCTACGTTGAAAACCAAAAAC -3'
Posted On2016-07-22