Incidental Mutation 'R5229:Man2a1'
ID403686
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5229 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64710734 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 658 (Q658H)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723] [ENSMUST00000169668]
Predicted Effect probably benign
Transcript: ENSMUST00000086723
AA Change: Q658H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: Q658H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169239
Predicted Effect probably benign
Transcript: ENSMUST00000169668
SMART Domains Protein: ENSMUSP00000130529
Gene: ENSMUSG00000024085

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 1 268 1.6e-50 PFAM
Meta Mutation Damage Score 0.2168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Dpysl3 C A 18: 43,332,951 G457V probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGAGAATTTATTTGGGG -3'
(R):5'- ACAGTGTGTTACAGAAGCCTG -3'

Sequencing Primer
(F):5'- AGGCAGAGTTTCTCACTGTAACC -3'
(R):5'- GTGGCCATCACGTACCTCATAG -3'
Posted On2016-07-22