Incidental Mutation 'R5229:Dpysl3'
ID403687
Institutional Source Beutler Lab
Gene Symbol Dpysl3
Ensembl Gene ENSMUSG00000024501
Gene Namedihydropyrimidinase-like 3
SynonymsTUC4, Ulip, Ulip1, CRMP-4
MMRRC Submission 042802-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R5229 (G1)
Quality Score192
Status Validated
Chromosome18
Chromosomal Location43320979-43438286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43332951 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 457 (G457V)
Ref Sequence ENSEMBL: ENSMUSP00000112928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025379] [ENSMUST00000118043] [ENSMUST00000118071] [ENSMUST00000121805] [ENSMUST00000124207]
Predicted Effect probably damaging
Transcript: ENSMUST00000025379
AA Change: G344V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025379
Gene: ENSMUSG00000024501
AA Change: G344V

DomainStartEndE-ValueType
Pfam:Amidohydro_5 35 104 8e-13 PFAM
Pfam:Amidohydro_4 59 410 3.4e-14 PFAM
Pfam:Amidohydro_1 64 413 7.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118043
AA Change: G342V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113711
Gene: ENSMUSG00000024501
AA Change: G342V

DomainStartEndE-ValueType
Pfam:Amidohydro_5 33 102 2e-13 PFAM
Pfam:Amidohydro_4 57 408 8.8e-15 PFAM
Pfam:Amidohydro_1 62 411 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118071
SMART Domains Protein: ENSMUSP00000113604
Gene: ENSMUSG00000024501

DomainStartEndE-ValueType
PDB:4BKN|B 1 91 2e-58 PDB
SCOP:d1gkra2 1 96 3e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121805
AA Change: G457V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112928
Gene: ENSMUSG00000024501
AA Change: G457V

DomainStartEndE-ValueType
low complexity region 85 102 N/A INTRINSIC
Pfam:Amidohydro_1 177 566 1.4e-41 PFAM
Pfam:Amidohydro_3 481 566 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124207
AA Change: G133V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114981
Gene: ENSMUSG00000024501
AA Change: G133V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 6 202 1e-23 PFAM
Pfam:Amidohydro_4 16 199 1.2e-8 PFAM
Meta Mutation Damage Score 0.7818 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the TUC (TOAD-64/Ulip/CRMP) family of proteins. Members of this family are phosphoproteins that function in axonal guidance and neuronal differentiation during development and regeneration of the nervous system. A mutation in the human gene is associated with amyotrophic lateral sclerosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired axon extension, abnormal neuron growth cones morphology and impaired anterograde transportation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik T C 1: 16,080,959 probably benign Het
4930562C15Rik A G 16: 4,850,051 I435M possibly damaging Het
8430408G22Rik T C 6: 116,652,031 S112P possibly damaging Het
Adcy5 A G 16: 35,269,070 I546V probably damaging Het
Apob A G 12: 7,977,806 T10A probably benign Het
Brwd1 C A 16: 96,002,209 D2254Y possibly damaging Het
Bub1b C A 2: 118,629,989 D600E probably damaging Het
C87499 T C 4: 88,630,135 D11G possibly damaging Het
Cnga1 A G 5: 72,609,500 S199P probably damaging Het
Cyp3a11 G T 5: 145,855,135 L483I probably benign Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Epb41 C A 4: 131,978,935 G415C probably damaging Het
Erap1 G A 13: 74,660,375 V69M possibly damaging Het
F2 A T 2: 91,630,241 Y301* probably null Het
F2rl2 A T 13: 95,700,687 N80I possibly damaging Het
Gm15446 T G 5: 109,943,170 H429Q probably damaging Het
Gm8773 A T 5: 5,575,565 Y87F possibly damaging Het
Gpat3 G A 5: 100,883,424 G148D probably damaging Het
Gpr26 A T 7: 131,984,247 R315S probably damaging Het
Hdac9 A C 12: 34,437,164 H100Q probably damaging Het
Heatr5a A T 12: 51,947,978 V457D probably benign Het
Igkv10-96 A G 6: 68,632,239 M24T possibly damaging Het
Igkv2-95-2 A G 6: 68,648,111 noncoding transcript Het
Kdm4a G A 4: 118,146,605 S758F probably damaging Het
Lrg1 A G 17: 56,120,154 W273R probably damaging Het
Man2a1 A T 17: 64,710,734 Q658H probably benign Het
Mapkapk5 T C 5: 121,533,391 probably null Het
Mcm6 T C 1: 128,333,584 D761G possibly damaging Het
Myh8 A T 11: 67,284,484 Y286F probably damaging Het
Nbn C T 4: 15,963,893 T98I probably damaging Het
Nrd1 T C 4: 109,049,108 S685P probably damaging Het
Nudcd3 A G 11: 6,193,238 V80A probably benign Het
Olfr121 A G 17: 37,752,301 H149R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pdcd6ip A T 9: 113,678,333 M390K probably damaging Het
Pon1 C T 6: 5,177,295 V205I possibly damaging Het
Ppp4r2 C A 6: 100,865,215 H212Q probably benign Het
Prl2c5 G A 13: 13,185,856 C33Y probably damaging Het
Rbak A G 5: 143,174,162 F379L probably damaging Het
Rcc2 G A 4: 140,717,029 D344N probably damaging Het
Rgs3 T C 4: 62,702,187 L550P probably damaging Het
Rnasek A T 11: 70,239,660 M25K probably damaging Het
Scgb1b24 A T 7: 33,744,095 T60S possibly damaging Het
Scn5a A G 9: 119,535,976 F392S probably damaging Het
Scpep1 A T 11: 88,937,045 V209E probably damaging Het
Slc35g1 A G 19: 38,402,632 probably null Het
Sorbs1 A G 19: 40,340,707 I554T probably damaging Het
Spats1 A G 17: 45,466,133 probably benign Het
Tdp1 A G 12: 99,893,660 Q202R probably damaging Het
Trav6-5 T G 14: 53,491,588 S102A probably damaging Het
Tspan2 T C 3: 102,768,899 M208T probably damaging Het
Ube4b A G 4: 149,387,178 S84P probably damaging Het
Vmn1r237 C A 17: 21,314,371 Q119K probably benign Het
Vmn2r125 C T 4: 156,351,038 T237I probably benign Het
Zfp65 A T 13: 67,708,810 S117T probably benign Het
Other mutations in Dpysl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Dpysl3 APN 18 43358300 missense probably damaging 1.00
IGL02533:Dpysl3 APN 18 43325794 missense probably benign 0.00
IGL02632:Dpysl3 APN 18 43393025 missense possibly damaging 0.50
IGL03111:Dpysl3 APN 18 43329845 missense probably damaging 1.00
IGL03138:Dpysl3 UTSW 18 43325794 missense probably benign 0.00
R0001:Dpysl3 UTSW 18 43358375 missense possibly damaging 0.93
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0656:Dpysl3 UTSW 18 43438071 missense possibly damaging 0.65
R1522:Dpysl3 UTSW 18 43363557 missense probably damaging 1.00
R1694:Dpysl3 UTSW 18 43328374 missense possibly damaging 0.94
R1764:Dpysl3 UTSW 18 43363518 missense probably damaging 1.00
R1822:Dpysl3 UTSW 18 43342328 missense probably benign 0.07
R1880:Dpysl3 UTSW 18 43329874 splice site probably null
R1907:Dpysl3 UTSW 18 43438128 missense probably damaging 1.00
R1925:Dpysl3 UTSW 18 43332931 missense probably damaging 1.00
R2248:Dpysl3 UTSW 18 43358293 missense possibly damaging 0.56
R3434:Dpysl3 UTSW 18 43361061 missense probably benign 0.01
R4575:Dpysl3 UTSW 18 43342247 missense probably damaging 1.00
R4778:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4780:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4858:Dpysl3 UTSW 18 43334014 missense probably damaging 0.96
R4987:Dpysl3 UTSW 18 43328427 missense probably benign 0.00
R5151:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5152:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5373:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5374:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5383:Dpysl3 UTSW 18 43438038 missense probably damaging 1.00
R6014:Dpysl3 UTSW 18 43361067 missense probably damaging 1.00
R6837:Dpysl3 UTSW 18 43437882 missense probably benign 0.01
R6958:Dpysl3 UTSW 18 43438002 missense probably benign
R6991:Dpysl3 UTSW 18 43353891 missense probably damaging 1.00
R7087:Dpysl3 UTSW 18 43363530 missense probably damaging 1.00
R7196:Dpysl3 UTSW 18 43329845 missense probably damaging 1.00
R7223:Dpysl3 UTSW 18 43438042 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCTTCAAGGATTCCCTGAGGG -3'
(R):5'- GAGTCTTTGTAATTGGCCACAG -3'

Sequencing Primer
(F):5'- GACAGGTTTTAGTTTGATTAGTGCC -3'
(R):5'- CCTCACTTTACGGATGGGTAGCAG -3'
Posted On2016-07-22