Incidental Mutation 'R5230:Kif21b'
ID403695
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136171673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1473 (V1473M)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: V1473M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: V1473M

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130864
AA Change: V1473M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: V1473M

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165333
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Egf T C 3: 129,718,024 D498G possibly damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Nrg1 T A 8: 31,818,479 Y503F probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spata31d1c T A 13: 65,035,434 N263K probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Vmn1r222 T G 13: 23,233,002 M14L probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0629_Kif21b_729 UTSW 1 136172157 critical splice acceptor site probably null
Schiessen UTSW 1 136147869 critical splice donor site probably null
wolfen UTSW 1 136144758 nonsense probably null
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
R7975:Kif21b UTSW 1 136171173 missense probably damaging 1.00
R8356:Kif21b UTSW 1 136172945 missense probably damaging 1.00
R8467:Kif21b UTSW 1 136172283 missense probably damaging 0.98
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136154137 missense probably benign 0.00
Z1177:Kif21b UTSW 1 136148312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCTGAAAATCTTGGTCC -3'
(R):5'- ACTGAGGTCGTTACTTTTCACC -3'

Sequencing Primer
(F):5'- AGAGTGGCCAGGATTATCTATTCC -3'
(R):5'- AGGTCGTTACTTTTCACCATTTACAG -3'
Posted On2016-07-22