Incidental Mutation 'R5230:Egf'
ID403703
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Nameepidermal growth factor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129677565-129755316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129718024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 498 (D498G)
Ref Sequence ENSEMBL: ENSMUSP00000029653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653] [ENSMUST00000197079] [ENSMUST00000197713] [ENSMUST00000199615]
PDB Structure ROLE OF THE 6-20 DISULFIDE BRIDGE IN THE STRUCTURE AND ACTIVITY OF EPIDERMAL GROWTH FACTOR, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
THREE-DIMENSIONAL NUCLEAR MAGNETIC RESONANCE STRUCTURES OF MOUSE EPIDERMAL GROWTH FACTOR IN ACIDIC AND PHYSIOLOGICAL PH SOLUTIONS [SOLUTION NMR]
SOLUTION STRUCTURE THE MEGF/TGFALPHA44-50 CHIMERIC GROWTH FACTOR [SOLUTION NMR]
SOLUTION STRUCTURE OF MURINE EPIDERMAL GROWTH FACTOR DETERMINED BY NMR SPECTROSCOPY AND REFINED BY ENERGY MINIMIZATION WITH RESTRAINTS [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029653
AA Change: D498G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: D498G

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197079
SMART Domains Protein: ENSMUSP00000143075
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF_like 418 458 1.7e-6 SMART
EGF 480 518 1.3e-6 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197713
SMART Domains Protein: ENSMUSP00000143108
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199615
SMART Domains Protein: ENSMUSP00000142497
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF 439 477 1.3e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 538 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Kif21b G A 1: 136,171,673 V1473M probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Nrg1 T A 8: 31,818,479 Y503F probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spata31d1c T A 13: 65,035,434 N263K probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Vmn1r222 T G 13: 23,233,002 M14L probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129711449 missense probably benign 0.01
IGL00579:Egf APN 3 129697798 missense probably benign 0.36
IGL01307:Egf APN 3 129739993 missense probably damaging 0.99
IGL01314:Egf APN 3 129686260 missense probably benign 0.16
IGL01360:Egf APN 3 129740020 missense probably damaging 1.00
IGL01367:Egf APN 3 129702455 critical splice donor site probably null
IGL01610:Egf APN 3 129706260 splice site probably benign
IGL01721:Egf APN 3 129697722 nonsense probably null
IGL01803:Egf APN 3 129736766 missense probably benign 0.09
IGL01866:Egf APN 3 129735880 missense probably benign 0.03
IGL02001:Egf APN 3 129716768 missense probably damaging 1.00
IGL02141:Egf APN 3 129739982 nonsense probably null
IGL02209:Egf APN 3 129707307 missense possibly damaging 0.93
IGL02347:Egf APN 3 129678377 missense probably benign 0.17
IGL02821:Egf APN 3 129702479 missense probably damaging 1.00
IGL02902:Egf APN 3 129681147 missense probably benign 0.34
IGL03114:Egf APN 3 129736880 missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129702549 missense probably benign 0.00
R0200:Egf UTSW 3 129706233 missense probably benign 0.00
R0200:Egf UTSW 3 129737549 missense probably damaging 1.00
R0463:Egf UTSW 3 129706233 missense probably benign 0.00
R0463:Egf UTSW 3 129737549 missense probably damaging 1.00
R0507:Egf UTSW 3 129681179 missense possibly damaging 0.62
R0801:Egf UTSW 3 129702585 splice site probably benign
R1495:Egf UTSW 3 129713006 missense probably damaging 1.00
R1535:Egf UTSW 3 129690778 missense probably benign 0.00
R1626:Egf UTSW 3 129686215 missense possibly damaging 0.55
R1702:Egf UTSW 3 129690811 missense probably benign 0.17
R1906:Egf UTSW 3 129725224 missense probably benign 0.01
R2184:Egf UTSW 3 129723358 nonsense probably null
R3842:Egf UTSW 3 129697793 nonsense probably null
R3918:Egf UTSW 3 129696860 missense probably null 0.22
R4073:Egf UTSW 3 129735969 missense probably benign 0.01
R4074:Egf UTSW 3 129735969 missense probably benign 0.01
R4075:Egf UTSW 3 129735969 missense probably benign 0.01
R4307:Egf UTSW 3 129719095 missense probably damaging 0.99
R4321:Egf UTSW 3 129706134 missense probably damaging 1.00
R4617:Egf UTSW 3 129690793 missense probably benign 0.02
R4646:Egf UTSW 3 129720276 missense probably damaging 1.00
R4674:Egf UTSW 3 129718040 missense probably damaging 1.00
R4798:Egf UTSW 3 129716678 missense probably damaging 1.00
R4931:Egf UTSW 3 129711468 missense probably damaging 1.00
R4992:Egf UTSW 3 129711530 splice site probably null
R5166:Egf UTSW 3 129735840 missense probably benign
R5179:Egf UTSW 3 129686287 missense probably damaging 0.99
R6043:Egf UTSW 3 129736785 missense probably benign 0.09
R6119:Egf UTSW 3 129736772 missense probably benign 0.00
R6493:Egf UTSW 3 129719088 start gained probably benign
R6639:Egf UTSW 3 129736832 missense probably benign 0.22
R6936:Egf UTSW 3 129681204 missense possibly damaging 0.95
R7019:Egf UTSW 3 129718064 splice site probably null
R7046:Egf UTSW 3 129754958 missense unknown
R7463:Egf UTSW 3 129740015 missense probably benign 0.39
R7472:Egf UTSW 3 129686263 missense possibly damaging 0.53
R7723:Egf UTSW 3 129706137 missense probably benign 0.00
R7920:Egf UTSW 3 129735840 missense probably benign
R7952:Egf UTSW 3 129739996 missense probably damaging 1.00
R8098:Egf UTSW 3 129690837 missense probably benign 0.09
R8344:Egf UTSW 3 129754943 missense unknown
R8557:Egf UTSW 3 129754951 missense unknown
R8912:Egf UTSW 3 129737515 missense possibly damaging 0.47
X0011:Egf UTSW 3 129711298 missense probably benign 0.19
Z1176:Egf UTSW 3 129697717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAGGAGGCCAGGTCATCAGTG -3'
(R):5'- GCCCAGAGATGAAATCTTGCAAG -3'

Sequencing Primer
(F):5'- GGTCATCAGTGAAGCTAAAATCCTC -3'
(R):5'- ATCTTGCAAGAGGGGAAGGTCTTTC -3'
Posted On2016-07-22