Incidental Mutation 'R5230:Nrg1'
ID403718
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Nameneuregulin 1
SynonymsD230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5230 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location31814551-32884029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31818479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 503 (Y503F)
Ref Sequence ENSEMBL: ENSMUSP00000146617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000208819] [ENSMUST00000209107]
Predicted Effect probably benign
Transcript: ENSMUST00000073884
AA Change: Y551F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: Y551F

DomainStartEndE-ValueType
transmembrane domain 78 100 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
EGF 236 277 7.88e-4 SMART
Pfam:Neuregulin 295 688 5.3e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207417
AA Change: Y488F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000207470
AA Change: Y496F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207678
Predicted Effect probably benign
Transcript: ENSMUST00000208205
AA Change: Y491F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000208335
Predicted Effect probably benign
Transcript: ENSMUST00000208488
AA Change: Y514F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000208497
Predicted Effect probably benign
Transcript: ENSMUST00000208598
Predicted Effect probably benign
Transcript: ENSMUST00000208617
Predicted Effect probably benign
Transcript: ENSMUST00000208819
Predicted Effect probably damaging
Transcript: ENSMUST00000209107
AA Change: Y503F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,674,861 N1296S probably damaging Het
Abca5 A T 11: 110,319,860 D164E probably benign Het
Adamts5 T C 16: 85,870,068 D512G probably damaging Het
Ankrd11 G A 8: 122,890,477 T2191I probably benign Het
Anxa3 T C 5: 96,838,312 F270S possibly damaging Het
Bard1 A G 1: 71,053,611 probably null Het
Ccdc142 T C 6: 83,107,796 V591A probably damaging Het
Col6a3 C T 1: 90,789,054 E1613K unknown Het
Dnah9 T A 11: 66,084,666 H1519L probably damaging Het
Egf T C 3: 129,718,024 D498G possibly damaging Het
Enah A C 1: 181,935,670 probably benign Het
Fat3 A T 9: 15,990,560 N3056K possibly damaging Het
Gm4846 T A 1: 166,490,179 N223Y probably benign Het
Gm8104 A G 14: 43,101,518 N55S probably damaging Het
Gpatch8 A G 11: 102,479,578 S1045P probably damaging Het
Haus4 A G 14: 54,543,794 M275T probably benign Het
Ighe T A 12: 113,271,386 T385S unknown Het
Ipo9 G A 1: 135,420,070 S78L probably damaging Het
Kif21b G A 1: 136,171,673 V1473M probably damaging Het
Lama1 T A 17: 67,745,083 Y345* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Loxl3 A G 6: 83,035,794 T105A probably benign Het
Map4k3 A G 17: 80,615,170 S441P probably benign Het
Med12l C T 3: 59,245,788 T1078I probably damaging Het
Mef2c T A 13: 83,652,907 M242K possibly damaging Het
Morc2b A G 17: 33,136,252 Y849H probably benign Het
Mroh2b T A 15: 4,941,522 V1003E probably benign Het
Myo15 T A 11: 60,502,848 M1135K possibly damaging Het
Nckap1l A T 15: 103,483,639 I834F probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1314 A T 2: 112,092,389 I104N probably benign Het
Pcdhga2 T C 18: 37,669,742 V213A probably benign Het
Pdzd2 A T 15: 12,390,033 M826K probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Rnf38 T C 4: 44,149,176 Q57R probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpina6 T C 12: 103,651,898 T219A probably benign Het
Spata31d1c T A 13: 65,035,434 N263K probably benign Het
Spef2 T G 15: 9,667,230 I791L possibly damaging Het
Sv2a T C 3: 96,185,460 C159R probably damaging Het
Tbc1d31 T A 15: 57,960,919 L859Q probably damaging Het
Tecta C A 9: 42,394,943 R63L probably damaging Het
Tex52 A G 6: 128,384,816 E252G probably damaging Het
Tnfsf13b A G 8: 10,031,608 I257V possibly damaging Het
Tpk1 A G 6: 43,423,719 L172P probably damaging Het
Trim3 T G 7: 105,619,513 N78T possibly damaging Het
Try5 A G 6: 41,312,378 V88A probably benign Het
Vmn1r222 T G 13: 23,233,002 M14L probably benign Het
Wdr90 A T 17: 25,855,303 V678E probably benign Het
Zan A G 5: 137,454,078 L1543P unknown Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 31818089 missense probably damaging 0.99
IGL00500:Nrg1 APN 8 31822314 unclassified probably null
IGL01150:Nrg1 APN 8 31917875 missense probably damaging 1.00
IGL01998:Nrg1 APN 8 31918134 missense probably damaging 0.99
IGL02010:Nrg1 APN 8 31918143 missense probably benign 0.00
IGL02501:Nrg1 APN 8 31818263 unclassified probably null
IGL02741:Nrg1 APN 8 31822288 missense probably damaging 1.00
IGL02754:Nrg1 APN 8 31826363 splice site probably benign
IGL03056:Nrg1 APN 8 31821423 missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 31824580 splice site probably benign
R6805_Nrg1_535 UTSW 8 31821264 missense probably damaging 1.00
R0533:Nrg1 UTSW 8 31831245 intron probably null
R1170:Nrg1 UTSW 8 31837667 splice site probably benign
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1486:Nrg1 UTSW 8 31818344 missense probably damaging 1.00
R1642:Nrg1 UTSW 8 31824508 missense probably benign 0.45
R1653:Nrg1 UTSW 8 31818653 missense probably damaging 1.00
R1762:Nrg1 UTSW 8 31822323 missense probably damaging 0.99
R1951:Nrg1 UTSW 8 31918193 missense probably damaging 1.00
R2060:Nrg1 UTSW 8 31918015 missense probably damaging 1.00
R2912:Nrg1 UTSW 8 31818567 missense probably damaging 1.00
R3786:Nrg1 UTSW 8 31821383 missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32477077 intron probably benign
R4569:Nrg1 UTSW 8 31917774 missense probably benign 0.00
R4760:Nrg1 UTSW 8 31918200 nonsense probably null
R4769:Nrg1 UTSW 8 31917972 missense probably damaging 1.00
R4834:Nrg1 UTSW 8 31917719 missense probably benign
R5058:Nrg1 UTSW 8 31824559 missense probably damaging 1.00
R5443:Nrg1 UTSW 8 31849320 missense probably damaging 1.00
R5479:Nrg1 UTSW 8 31818377 missense probably damaging 1.00
R5940:Nrg1 UTSW 8 31849344 missense probably damaging 0.99
R6010:Nrg1 UTSW 8 31818572 missense probably damaging 1.00
R6170:Nrg1 UTSW 8 31818480 missense probably damaging 1.00
R6379:Nrg1 UTSW 8 32883721 start gained probably benign
R6460:Nrg1 UTSW 8 31818533 missense probably damaging 1.00
R6750:Nrg1 UTSW 8 31818096 missense probably damaging 1.00
R6767:Nrg1 UTSW 8 31917895 missense probably damaging 1.00
R6802:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6804:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6805:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6848:Nrg1 UTSW 8 31818056 missense probably damaging 1.00
R6930:Nrg1 UTSW 8 31818506 missense probably damaging 1.00
R6963:Nrg1 UTSW 8 31917662 missense probably benign 0.04
R7070:Nrg1 UTSW 8 31849437 missense probably damaging 0.99
R7176:Nrg1 UTSW 8 31968036 nonsense probably null
R7490:Nrg1 UTSW 8 31818654 missense probably damaging 1.00
R7526:Nrg1 UTSW 8 31818323 missense probably benign 0.00
R7664:Nrg1 UTSW 8 32009141 utr 5 prime probably null
R7881:Nrg1 UTSW 8 31838324 nonsense probably null
R7964:Nrg1 UTSW 8 31838324 nonsense probably null
R8013:Nrg1 UTSW 8 31949923 missense probably benign 0.41
Z1088:Nrg1 UTSW 8 31918005 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACAGAACTTGGGTTGCTGTCC -3'
(R):5'- CACCTGTAGATTTCCACACGC -3'

Sequencing Primer
(F):5'- CAACCTATTGGCAATGTGGC -3'
(R):5'- TGTAGATTTCCACACGCCAAGC -3'
Posted On2016-07-22