Incidental Mutation 'R0417:Mga'
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 038619-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0417 (G1)
Quality Score225
Status Not validated
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119902790 bp
Amino Acid Change Isoleucine to Valine at position 40 (I40V)
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably damaging
Transcript: ENSMUST00000046717
AA Change: I40V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: I40V

Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079934
AA Change: I40V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: I40V

Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110773
AA Change: I40V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: I40V

Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110774
AA Change: I40V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: I40V

Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141776
Predicted Effect probably damaging
Transcript: ENSMUST00000156510
AA Change: I40V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: I40V

Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,483 L102P probably damaging Het
1700030K09Rik A G 8: 72,445,400 K217R probably damaging Het
1810024B03Rik A G 2: 127,186,944 Y112H probably damaging Het
A430078G23Rik T C 8: 3,388,957 probably benign Het
Acot2 T C 12: 83,990,613 Y234H probably benign Het
Alox12e C T 11: 70,321,865 V53I probably benign Het
Ankrd50 T C 3: 38,456,361 H619R probably damaging Het
Arfgef3 A T 10: 18,603,511 L1452Q probably damaging Het
Arhgap42 T C 9: 9,180,033 S82G possibly damaging Het
Bicra C A 7: 15,972,322 R1398L probably damaging Het
Boc T C 16: 44,520,234 T118A probably benign Het
Btnl9 A G 11: 49,175,595 Y381H probably damaging Het
Cbln3 T G 14: 55,884,129 E20A probably benign Het
Csrnp3 A G 2: 66,019,543 Y171C probably benign Het
Cyp2d9 A T 15: 82,455,951 I181F probably damaging Het
Cyp7b1 T A 3: 18,096,691 T295S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dok1 A T 6: 83,031,569 D377E probably damaging Het
Eed A T 7: 89,971,552 Y87* probably null Het
Entpd3 T C 9: 120,557,421 V156A probably damaging Het
Exo5 T A 4: 120,922,072 T199S probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Ezh2 A G 6: 47,551,726 C291R probably benign Het
Flvcr1 A T 1: 191,011,219 M466K probably benign Het
Fras1 G T 5: 96,691,372 M1583I probably benign Het
Fzd9 G T 5: 135,249,619 R471S probably damaging Het
Galr1 A T 18: 82,405,540 F204Y probably damaging Het
Gm38394 A T 1: 133,658,538 S354T probably benign Het
Gna11 A T 10: 81,530,904 I324N probably damaging Het
Gucy1a2 A G 9: 3,759,484 E430G possibly damaging Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Ikzf1 A C 11: 11,769,352 N353T probably benign Het
Il7 T A 3: 7,576,027 T110S probably damaging Het
Keg1 A G 19: 12,711,060 N53D probably damaging Het
Klhl21 T C 4: 152,015,507 I558T probably damaging Het
Lca5l G A 16: 96,162,653 T357M probably damaging Het
Lrba T C 3: 86,715,654 S2448P probably damaging Het
Map3k6 T A 4: 133,248,082 Y709* probably null Het
Megf6 A G 4: 154,267,967 E1261G probably benign Het
Mettl3 C T 14: 52,296,698 G473D probably damaging Het
Mmp13 T A 9: 7,276,602 D232E probably benign Het
Nampt T C 12: 32,833,101 V95A probably benign Het
Nbeal1 T C 1: 60,247,734 V905A probably benign Het
Nomo1 A T 7: 46,068,698 E840V possibly damaging Het
Nprl2 A T 9: 107,543,298 I101F probably damaging Het
Nup160 A T 2: 90,735,427 I1378F possibly damaging Het
Ogdhl T C 14: 32,326,979 S69P probably damaging Het
Olfr1105 A T 2: 87,033,445 Y259N probably damaging Het
Olfr1240 C A 2: 89,440,175 V35L possibly damaging Het
Olfr1283 A G 2: 111,369,105 S158G possibly damaging Het
Olfr1390 T A 11: 49,340,673 I47N possibly damaging Het
Olfr143 T C 9: 38,253,864 F149S probably benign Het
Olfr870 G A 9: 20,171,214 A119V probably damaging Het
Olfr894 A G 9: 38,219,455 I211V probably benign Het
Osbpl3 C T 6: 50,348,018 V167I probably benign Het
Pclo T A 5: 14,713,022 H3836Q unknown Het
Prkcg A T 7: 3,304,304 probably null Het
Ror1 A T 4: 100,412,000 H345L possibly damaging Het
Slc36a2 C T 11: 55,181,544 probably null Het
Slc40a1 G A 1: 45,911,374 P306L possibly damaging Het
Slc9a8 C A 2: 167,457,344 T239K probably benign Het
Snapc3 A G 4: 83,450,162 I299V probably benign Het
Sp3 G A 2: 72,971,501 A56V possibly damaging Het
Spag17 T A 3: 100,065,554 S1361T probably benign Het
Sptbn2 A G 19: 4,737,926 T978A probably benign Het
Stom C A 2: 35,321,632 V126F probably damaging Het
Stpg2 A G 3: 139,218,321 T162A probably damaging Het
Stxbp6 G A 12: 44,902,957 T63M probably damaging Het
Tatdn1 A C 15: 58,921,350 I69S probably benign Het
Tbata A T 10: 61,180,339 D198V probably damaging Het
Tbc1d5 T C 17: 50,756,705 I638V probably benign Het
Tomm70a A G 16: 57,149,903 D548G probably benign Het
Ust A G 10: 8,245,936 F303L probably damaging Het
Vps13d A G 4: 144,976,560 S4306P probably benign Het
Zfp691 A G 4: 119,170,496 S180P possibly damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
R7921:Mga UTSW 2 119919678 missense probably damaging 1.00
R8165:Mga UTSW 2 119947238 missense probably benign 0.12
R8226:Mga UTSW 2 119960385 missense probably benign 0.33
R8305:Mga UTSW 2 119946319 missense possibly damaging 0.77
R8309:Mga UTSW 2 119960930 missense probably damaging 1.00
R8363:Mga UTSW 2 119963926 missense probably benign 0.43
R8388:Mga UTSW 2 119964081 missense probably benign 0.00
R8524:Mga UTSW 2 119941516 missense probably damaging 0.97
R8693:Mga UTSW 2 119963926 missense possibly damaging 0.65
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acttgtgctctttctccatctc -3'
Posted On2013-05-23